Incidental Mutation 'R6338:Tdpoz2'
ID514311
Institutional Source Beutler Lab
Gene Symbol Tdpoz2
Ensembl Gene ENSMUSG00000103362
Gene NameTD and POZ domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93651542-93652686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93652336 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 110 (V110I)
Ref Sequence ENSEMBL: ENSMUSP00000141299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191960]
Predicted Effect probably benign
Transcript: ENSMUST00000191960
AA Change: V110I

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141299
Gene: ENSMUSG00000103362
AA Change: V110I

DomainStartEndE-ValueType
MATH 24 130 1.27e-6 SMART
BTB 188 287 7.44e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Tdpoz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02285:Tdpoz2 APN 3 93652291 missense probably damaging 1.00
IGL02350:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02357:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02887:Tdpoz2 APN 3 93651739 missense probably benign 0.43
FR4304:Tdpoz2 UTSW 3 93651615 frame shift probably null
FR4340:Tdpoz2 UTSW 3 93651615 frame shift probably null
R1502:Tdpoz2 UTSW 3 93652146 missense probably benign 0.01
R1943:Tdpoz2 UTSW 3 93651923 nonsense probably null
R4825:Tdpoz2 UTSW 3 93652074 missense possibly damaging 0.58
R5055:Tdpoz2 UTSW 3 93651928 missense probably damaging 1.00
R5096:Tdpoz2 UTSW 3 93652512 missense possibly damaging 0.87
R5398:Tdpoz2 UTSW 3 93652134 missense probably damaging 0.97
R6178:Tdpoz2 UTSW 3 93652311 missense probably benign 0.01
R6280:Tdpoz2 UTSW 3 93651883 missense probably benign 0.03
R6544:Tdpoz2 UTSW 3 93651960 missense possibly damaging 0.81
R6954:Tdpoz2 UTSW 3 93652275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTAGGTCATCTGTCAACATG -3'
(R):5'- TCTCCTTAGAGGCCAATGAGG -3'

Sequencing Primer
(F):5'- ATCTGTCAACATGTGTCTTGGATC -3'
(R):5'- CTCCTTAGAGGCCAATGAGGAAGTG -3'
Posted On2018-04-27