Incidental Mutation 'R6338:Fam13a'
ID514320
Institutional Source Beutler Lab
Gene Symbol Fam13a
Ensembl Gene ENSMUSG00000037709
Gene Namefamily with sequence similarity 13, member A
SynonymsD430015B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location58932090-59024549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58953499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000134135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089860] [ENSMUST00000173193]
Predicted Effect probably damaging
Transcript: ENSMUST00000089860
AA Change: V476A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087304
Gene: ENSMUSG00000037709
AA Change: V476A

DomainStartEndE-ValueType
Blast:RhoGAP 19 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 620 645 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173193
AA Change: V476A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134135
Gene: ENSMUSG00000037709
AA Change: V476A

DomainStartEndE-ValueType
Blast:RhoGAP 21 128 6e-27 BLAST
low complexity region 136 147 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 173 185 N/A INTRINSIC
coiled coil region 336 363 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
coiled coil region 592 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Fam13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Fam13a APN 6 58946126 missense probably benign 0.03
IGL00467:Fam13a APN 6 58940113 splice site probably benign
IGL01288:Fam13a APN 6 58956727 missense probably damaging 1.00
IGL01503:Fam13a APN 6 58956080 missense probably damaging 1.00
IGL01532:Fam13a APN 6 58940295 missense probably damaging 0.96
IGL02197:Fam13a APN 6 58935601 missense possibly damaging 0.65
IGL02206:Fam13a APN 6 58987219 missense probably benign 0.00
IGL03189:Fam13a APN 6 58956858 missense probably damaging 0.99
R0361:Fam13a UTSW 6 58987174 missense probably benign
R0512:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R0801:Fam13a UTSW 6 58984012 missense probably benign 0.01
R1222:Fam13a UTSW 6 58935722 splice site probably benign
R1378:Fam13a UTSW 6 58956751 missense probably benign 0.04
R1535:Fam13a UTSW 6 58939347 missense probably damaging 0.99
R1614:Fam13a UTSW 6 58940184 missense probably damaging 1.00
R1663:Fam13a UTSW 6 58954372 nonsense probably null
R1809:Fam13a UTSW 6 58965060 critical splice donor site probably null
R1905:Fam13a UTSW 6 58953490 missense probably damaging 1.00
R2568:Fam13a UTSW 6 58935609 missense probably damaging 1.00
R3771:Fam13a UTSW 6 58987186 missense probably benign 0.11
R4654:Fam13a UTSW 6 58987167 missense probably benign
R5244:Fam13a UTSW 6 58953474 nonsense probably null
R5488:Fam13a UTSW 6 59024318 missense probably null 1.00
R5489:Fam13a UTSW 6 59024318 missense probably null 1.00
R5712:Fam13a UTSW 6 58956699 missense probably damaging 1.00
R5729:Fam13a UTSW 6 58939307 missense probably damaging 0.99
R5969:Fam13a UTSW 6 58965198 missense probably damaging 1.00
R6074:Fam13a UTSW 6 58989738 splice site probably null
R6275:Fam13a UTSW 6 58954257 missense probably damaging 0.98
R6306:Fam13a UTSW 6 58940254 missense probably benign 0.02
R6603:Fam13a UTSW 6 58987189 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGTGTGAATATGCATTAAGCTTCC -3'
(R):5'- GGTAGCTGATTACAATGGTCATCTG -3'

Sequencing Primer
(F):5'- GCATTAAGCTTCCTTTCTTGTACAAG -3'
(R):5'- GATTACAATGGTCATCTGCACTCTG -3'
Posted On2018-04-27