Incidental Mutation 'R6338:Cd209e'
ID514330
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene NameCD209e antigen
SynonymsmSIGNR4, SIGNR4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3847965-3854309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3849154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 186 (D186V)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
Predicted Effect probably damaging
Transcript: ENSMUST00000033888
AA Change: D186V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: D186V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3852800 missense probably benign 0.05
IGL00920:Cd209e APN 8 3849187 missense probably damaging 1.00
IGL01132:Cd209e APN 8 3851274 missense probably benign 0.18
IGL02499:Cd209e APN 8 3854238 missense probably benign
R0124:Cd209e UTSW 8 3851274 missense probably benign 0.08
R0268:Cd209e UTSW 8 3849125 missense probably benign 0.34
R0540:Cd209e UTSW 8 3851265 missense probably benign 0.04
R0744:Cd209e UTSW 8 3853205 missense probably benign 0.00
R0836:Cd209e UTSW 8 3853205 missense probably benign 0.00
R1241:Cd209e UTSW 8 3849124 missense probably damaging 0.99
R1367:Cd209e UTSW 8 3849084 makesense probably null
R2040:Cd209e UTSW 8 3849158 missense probably damaging 1.00
R2136:Cd209e UTSW 8 3853248 missense probably benign 0.00
R4787:Cd209e UTSW 8 3851181 missense probably null 0.69
R6283:Cd209e UTSW 8 3849212 nonsense probably null
R6894:Cd209e UTSW 8 3853569 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CCATGCCCATAGACAGGGAG -3'
(R):5'- AAGACTTCATACGATGCAGGTAG -3'

Sequencing Primer
(F):5'- CCCATAGACAGGGAGTAGGAACTG -3'
(R):5'- AAGGTCTGTCCATCACGATG -3'
Posted On2018-04-27