Incidental Mutation 'R6338:Olfr1390'
ID514342
Institutional Source Beutler Lab
Gene Symbol Olfr1390
Ensembl Gene ENSMUSG00000045421
Gene Nameolfactory receptor 1390
SynonymsGA_x6K02T2QP88-6094111-6093176, MOR256-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49335188-49342247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49340867 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 112 (S112G)
Ref Sequence ENSEMBL: ENSMUSP00000151059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062719] [ENSMUST00000215014]
Predicted Effect probably benign
Transcript: ENSMUST00000062719
AA Change: S112G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000053611
Gene: ENSMUSG00000045421
AA Change: S112G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 230 2.8e-6 PFAM
Pfam:7tm_1 41 289 2.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215014
AA Change: S112G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Olfr1390
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Olfr1390 APN 11 49341306 missense probably benign 0.44
IGL02334:Olfr1390 APN 11 49341191 missense probably benign 0.09
IGL02958:Olfr1390 APN 11 49341300 missense probably benign 0.44
PIT4402001:Olfr1390 UTSW 11 49341399 missense probably damaging 1.00
R0149:Olfr1390 UTSW 11 49340814 missense probably benign 0.07
R0361:Olfr1390 UTSW 11 49340814 missense probably benign 0.07
R0417:Olfr1390 UTSW 11 49340673 missense possibly damaging 0.88
R1187:Olfr1390 UTSW 11 49340590 missense probably damaging 1.00
R1859:Olfr1390 UTSW 11 49341384 missense probably damaging 1.00
R1882:Olfr1390 UTSW 11 49340712 missense probably damaging 1.00
R1885:Olfr1390 UTSW 11 49340835 missense probably damaging 1.00
R2193:Olfr1390 UTSW 11 49340943 missense possibly damaging 0.70
R2322:Olfr1390 UTSW 11 49340649 missense probably damaging 1.00
R3929:Olfr1390 UTSW 11 49340993 missense probably benign 0.00
R4739:Olfr1390 UTSW 11 49341321 missense probably benign 0.00
R4939:Olfr1390 UTSW 11 49340549 missense probably benign 0.00
R5977:Olfr1390 UTSW 11 49340765 missense probably damaging 0.96
R6864:Olfr1390 UTSW 11 49340753 missense probably damaging 0.99
R7045:Olfr1390 UTSW 11 49340930 missense probably damaging 0.96
R7276:Olfr1390 UTSW 11 49340994 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTCGGCTTCAAATGCCCATG -3'
(R):5'- GCCAACTTCAGGAGACTAGGTATC -3'

Sequencing Primer
(F):5'- GGCTTCAAATGCCCATGTACTTC -3'
(R):5'- CTTCAGGAGACTAGGTATCTCACAG -3'
Posted On2018-04-27