Incidental Mutation 'R6338:Gm11639'
ID514347
Institutional Source Beutler Lab
Gene Symbol Gm11639
Ensembl Gene ENSMUSG00000040838
Gene Namepredicted gene 11639
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location104685707-105117394 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 104843208 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 2027 (R2027*)
Ref Sequence ENSEMBL: ENSMUSP00000148433 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000212287
AA Change: R2027*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Other mutations in Gm11639
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Gm11639 APN 11 105100021 missense probably damaging 1.00
IGL01308:Gm11639 APN 11 104720697 missense probably benign 0.03
IGL01483:Gm11639 APN 11 104739347 missense probably benign 0.03
IGL01695:Gm11639 APN 11 104736063 missense probably damaging 1.00
IGL01860:Gm11639 APN 11 104690921 missense probably benign 0.16
IGL01981:Gm11639 APN 11 104721432 intron probably benign
IGL01984:Gm11639 APN 11 104738308 missense probably benign 0.20
IGL02023:Gm11639 APN 11 104721432 intron probably benign
IGL02252:Gm11639 APN 11 104753927 missense possibly damaging 0.68
IGL02886:Gm11639 APN 11 105095874 missense possibly damaging 0.95
IGL03116:Gm11639 APN 11 104721533 missense probably benign 0.02
IGL03141:Gm11639 APN 11 105095870 missense probably damaging 0.99
IGL03242:Gm11639 APN 11 105106404 missense probably damaging 1.00
IGL03274:Gm11639 APN 11 104721093 missense probably benign 0.03
IGL03408:Gm11639 APN 11 104710621 missense probably benign 0.03
R0018:Gm11639 UTSW 11 104721552 critical splice donor site probably null
R0068:Gm11639 UTSW 11 104720822 missense probably benign 0.29
R0350:Gm11639 UTSW 11 104690880 missense probably benign 0.03
R0646:Gm11639 UTSW 11 104720501 missense probably benign 0.03
R0668:Gm11639 UTSW 11 104720492 missense probably benign 0.16
R0715:Gm11639 UTSW 11 104720880 missense possibly damaging 0.90
R0944:Gm11639 UTSW 11 104710730 splice site probably null
R1330:Gm11639 UTSW 11 104746290 missense possibly damaging 0.84
R1508:Gm11639 UTSW 11 104710677 missense probably benign 0.03
R1643:Gm11639 UTSW 11 104698978 missense probably benign 0.16
R1651:Gm11639 UTSW 11 104720666 missense probably benign 0.03
R1665:Gm11639 UTSW 11 104721114 missense probably benign 0.07
R1702:Gm11639 UTSW 11 104691006 missense probably benign 0.03
R1711:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1779:Gm11639 UTSW 11 104720939 missense probably benign 0.15
R1813:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1818:Gm11639 UTSW 11 104721507 missense probably benign 0.10
R1896:Gm11639 UTSW 11 104720688 missense probably benign 0.07
R1969:Gm11639 UTSW 11 104746264 missense probably damaging 1.00
R2139:Gm11639 UTSW 11 104751911 missense possibly damaging 0.53
R2165:Gm11639 UTSW 11 104751862 missense possibly damaging 0.93
R2359:Gm11639 UTSW 11 104739280 missense possibly damaging 0.80
R2394:Gm11639 UTSW 11 104738295 missense probably benign 0.17
R2406:Gm11639 UTSW 11 104720631 missense probably benign 0.03
R2570:Gm11639 UTSW 11 104733664 missense probably damaging 1.00
R3795:Gm11639 UTSW 11 104733675 missense possibly damaging 0.94
R4352:Gm11639 UTSW 11 104739314 missense probably null 0.25
R4359:Gm11639 UTSW 11 104733721 splice site probably null
R4424:Gm11639 UTSW 11 104736114 critical splice donor site probably null
R4895:Gm11639 UTSW 11 104720286 missense probably benign 0.16
R4895:Gm11639 UTSW 11 104749670 missense probably damaging 1.00
R5006:Gm11639 UTSW 11 104729677 splice site probably null
R5066:Gm11639 UTSW 11 104720664 missense probably benign 0.03
R5329:Gm11639 UTSW 11 104753806 intron probably null
R5405:Gm11639 UTSW 11 104721192 missense probably benign 0.07
R5814:Gm11639 UTSW 11 104736114 critical splice donor site probably benign
R5888:Gm11639 UTSW 11 104721401 splice site probably benign
R5910:Gm11639 UTSW 11 104690934 missense probably benign 0.01
R5975:Gm11639 UTSW 11 104687549 start gained probably benign
R6019:Gm11639 UTSW 11 105042902 critical splice donor site probably null
R6028:Gm11639 UTSW 11 104769655 critical splice donor site probably null
R6048:Gm11639 UTSW 11 104944433 missense unknown
R6059:Gm11639 UTSW 11 105036769 missense probably benign 0.03
R6147:Gm11639 UTSW 11 104967740 missense unknown
R6176:Gm11639 UTSW 11 104792557 missense probably benign 0.16
R6181:Gm11639 UTSW 11 104831333 missense probably benign 0.25
R6196:Gm11639 UTSW 11 104855560 missense probably benign 0.07
R6245:Gm11639 UTSW 11 104785008 missense probably benign 0.03
R6262:Gm11639 UTSW 11 104893753 missense probably benign 0.24
R6263:Gm11639 UTSW 11 104919486 missense unknown
R6277:Gm11639 UTSW 11 105010322 missense possibly damaging 0.49
R6355:Gm11639 UTSW 11 105005685 missense probably benign 0.29
R6356:Gm11639 UTSW 11 104893707 missense probably benign 0.19
R6365:Gm11639 UTSW 11 104924586 missense unknown
R6391:Gm11639 UTSW 11 104994317 missense possibly damaging 0.92
R6556:Gm11639 UTSW 11 105008251 missense probably null 0.03
R6604:Gm11639 UTSW 11 104698946 nonsense probably null
R6605:Gm11639 UTSW 11 104999281 splice site probably null
R6634:Gm11639 UTSW 11 104893783 missense probably benign 0.17
R6851:Gm11639 UTSW 11 105005695 missense probably benign 0.03
R6862:Gm11639 UTSW 11 104721458 nonsense probably null
R6949:Gm11639 UTSW 11 104909070 missense probably damaging 1.00
R6970:Gm11639 UTSW 11 104776356 missense probably benign 0.03
R7014:Gm11639 UTSW 11 104693422 missense probably benign 0.03
R7097:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7122:Gm11639 UTSW 11 105008961 missense possibly damaging 0.68
R7124:Gm11639 UTSW 11 104738274 missense probably benign 0.17
R7146:Gm11639 UTSW 11 104967752 missense unknown
R7146:Gm11639 UTSW 11 105022938 missense probably benign 0.03
R7154:Gm11639 UTSW 11 104699140 intron probably null
R7175:Gm11639 UTSW 11 104947411 missense unknown
R7198:Gm11639 UTSW 11 104751885 missense probably benign 0.15
R7211:Gm11639 UTSW 11 104710713 missense probably benign 0.01
R7211:Gm11639 UTSW 11 104724609 critical splice donor site probably null
R7216:Gm11639 UTSW 11 104880549 missense possibly damaging 0.49
R7221:Gm11639 UTSW 11 104900606 missense probably benign 0.36
R7233:Gm11639 UTSW 11 104839843 missense possibly damaging 0.69
R7236:Gm11639 UTSW 11 104899267 missense probably benign 0.10
R7289:Gm11639 UTSW 11 105038358 missense probably benign 0.24
R7323:Gm11639 UTSW 11 105030011 missense probably benign 0.07
R7378:Gm11639 UTSW 11 104714702 missense probably benign 0.03
R7388:Gm11639 UTSW 11 104721045 missense probably damaging 0.97
R7390:Gm11639 UTSW 11 104724585 missense possibly damaging 0.46
X0026:Gm11639 UTSW 11 104720975 missense probably benign 0.07
Z1088:Gm11639 UTSW 11 104751902 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACGGGTATAGAGGCCCATAG -3'
(R):5'- AAGCCACACAGCATCTAATTGTTTC -3'

Sequencing Primer
(F):5'- GAAGGGGCTTCTGTTATACAACTG -3'
(R):5'- CACTACTATCTGTAAGAATCCATGC -3'
Posted On2018-04-27