Incidental Mutation 'R6338:Zc3h14'
ID514349
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6338 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98758590 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057000
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110104
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110105
AA Change: D170E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222913
Predicted Effect probably benign
Transcript: ENSMUST00000223083
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 T C 7: 98,257,715 Y128C probably damaging Het
Adam30 T G 3: 98,161,541 I102S probably damaging Het
Adcy8 A T 15: 64,920,617 D163E possibly damaging Het
Agrn C T 4: 156,170,585 E1614K probably benign Het
Aldh16a1 A T 7: 45,141,961 W107R probably damaging Het
Arfgef2 A G 2: 166,845,570 D238G probably damaging Het
Arhgap11a T C 2: 113,833,725 S738G probably benign Het
Arid5b C A 10: 68,098,561 G504* probably null Het
Carmil3 T C 14: 55,499,849 V763A possibly damaging Het
Cd209e T A 8: 3,849,154 D186V probably damaging Het
Cdh23 T C 10: 60,413,151 D882G probably damaging Het
Cdh4 T C 2: 179,890,812 V689A probably damaging Het
Cntn6 T A 6: 104,726,139 V174E probably damaging Het
Col7a1 C T 9: 108,956,633 T390M unknown Het
Crybg1 T C 10: 43,992,509 D1017G probably damaging Het
Csmd1 T G 8: 15,932,492 K2725T possibly damaging Het
Dnaaf2 T C 12: 69,198,122 E55G probably damaging Het
Fam13a A G 6: 58,953,499 V476A probably damaging Het
Fem1b A T 9: 62,797,011 D322E probably benign Het
Frmpd1 G A 4: 45,274,489 V466I probably benign Het
Gm11639 C T 11: 104,843,208 R2027* probably null Het
Gm20671 A T 5: 32,820,647 D1794E probably damaging Het
Gpatch2 G T 1: 187,225,514 R22L probably damaging Het
Gtf2h1 A G 7: 46,816,456 T450A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Krit1 T G 5: 3,836,857 M702R probably benign Het
Krt34 T C 11: 100,038,490 N298S probably benign Het
Lrrcc1 T A 3: 14,547,316 N376K possibly damaging Het
Myo15 A G 11: 60,478,133 E573G probably damaging Het
Olfr1224-ps1 T A 2: 89,156,371 K268I probably damaging Het
Olfr1390 A G 11: 49,340,867 S112G probably benign Het
Olfr366 A T 2: 37,219,822 D111V probably damaging Het
Olfr391-ps A T 11: 73,799,319 L146Q possibly damaging Het
Olfr661 T A 7: 104,688,171 V52E possibly damaging Het
Olfr736 T A 14: 50,393,400 F215I possibly damaging Het
Phf20 A T 2: 156,273,686 Q309L possibly damaging Het
Plcd1 G A 9: 119,074,991 R292C probably damaging Het
Pold3 A G 7: 100,088,105 V342A possibly damaging Het
Polr2a A T 11: 69,739,679 probably null Het
Ptprcap A G 19: 4,156,224 E102G probably benign Het
Rab11fip5 T C 6: 85,341,378 E843G possibly damaging Het
Rai14 T C 15: 10,574,976 D632G probably damaging Het
Rnf149 A T 1: 39,560,742 C268S probably null Het
Slc6a13 T A 6: 121,334,839 F392I probably damaging Het
Slc7a11 C T 3: 50,384,043 probably null Het
Slf1 T A 13: 77,084,462 probably null Het
Stard9 G A 2: 120,697,485 V1408I probably benign Het
Suclg1 T C 6: 73,264,246 I183T probably damaging Het
Syne1 T C 10: 5,255,475 E3497G probably benign Het
Tax1bp1 C T 6: 52,729,376 R121* probably null Het
Tdpoz2 C T 3: 93,652,336 V110I probably benign Het
Ubn2 A G 6: 38,490,714 T788A probably benign Het
Unc13c T A 9: 73,734,447 I1255F probably damaging Het
Usp44 G T 10: 93,846,513 R275I probably damaging Het
Uspl1 A G 5: 149,215,034 N1015D probably benign Het
Wbp2nl G T 15: 82,299,045 W13C possibly damaging Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAATGACTATTTGAAAGGCCTCC -3'
(R):5'- GGATGAAGTTGCAGCCTGTTTAAG -3'

Sequencing Primer
(F):5'- GACTATTTGAAAGGCCTCCATACTAC -3'
(R):5'- CAGCCTGTTTAAGTGAGTACCAG -3'
Posted On2018-04-27