Mutagenetix > Incidental Mutation

Incidental Mutation 'R6141:Tnfsf11'

514465

Institutional Source

Beutler Lab

Gene Symbol

Tnfsf11

Ensembl Gene

ENSMUSG00000022015

Gene Name

tumor necrosis factor (ligand) superfamily, member 11

Synonyms

Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF

MMRRC Submission

044288-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.478) question?

Stock #

R6141 (G1)

Quality Score

70.0074

Status

Validated

Chromosome

Chromosomal Location

78514886-78545483 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78545299 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 11 (Y11H)

Ref Sequence

ENSEMBL: ENSMUSP00000022592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022592]

AlphaFold

O35235

PDB Structure

CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022592
AA Change: Y11H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: Y11H

Domain	Start	End	E-Value	Type
low complexity region	32	46	N/A	INTRINSIC
transmembrane domain	49	71	N/A	INTRINSIC
TNF	163	312	7.37e-58	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175033

Meta Mutation Damage Score

0.1183

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933421I07Rik	A	T	7: 42,097,483 (GRCm39)	C4S	probably damaging	Het
Abhd5	A	T	9: 122,206,998 (GRCm39)	T95S	probably benign	Het
Ambra1	A	T	2: 91,706,099 (GRCm39)	N795Y	probably damaging	Het
Brca2	A	G	5: 150,464,102 (GRCm39)	N1289D	possibly damaging	Het
Cavin2	T	C	1: 51,340,097 (GRCm39)	L258P	probably damaging	Het
Ccdc110	A	G	8: 46,394,807 (GRCm39)	T233A	possibly damaging	Het
Ccdc14	T	A	16: 34,526,932 (GRCm39)	I279N	probably damaging	Het
Cntn5	A	T	9: 10,144,162 (GRCm39)	L169Q	probably benign	Het
Dbf4	T	C	5: 8,458,545 (GRCm39)	S157G	possibly damaging	Het
Defb22	A	T	2: 152,327,722 (GRCm39)	N154K	unknown	Het
Eepd1	T	A	9: 25,394,280 (GRCm39)	D181E	probably benign	Het
Etfa	T	C	9: 55,372,103 (GRCm39)	H286R	probably damaging	Het
Gm44419	T	A	6: 65,127,940 (GRCm39)		noncoding transcript	Het
Gpatch4	C	T	3: 87,962,047 (GRCm39)	R155*	probably null	Het
Grik1	T	G	16: 87,693,760 (GRCm39)	R862S	probably benign	Het
Hectd1	A	C	12: 51,792,875 (GRCm39)		probably null	Het
Ift122	T	C	6: 115,892,972 (GRCm39)	W919R	probably damaging	Het
Iqgap2	A	T	13: 95,858,194 (GRCm39)		probably null	Het
Kcnq4	A	T	4: 120,573,066 (GRCm39)	I245N	probably damaging	Het
Map3k3	G	T	11: 105,987,874 (GRCm39)	R21L	probably benign	Het
Mllt10	T	C	2: 18,215,604 (GRCm39)	V1063A	probably damaging	Het
Msr1	A	T	8: 40,084,360 (GRCm39)	V65E	probably damaging	Het
Myom2	A	T	8: 15,113,903 (GRCm39)	D17V	probably damaging	Het
Naaladl1	T	A	19: 6,159,785 (GRCm39)		probably null	Het
Naip6	T	C	13: 100,444,741 (GRCm39)	Y239C	possibly damaging	Het
Nckap1	C	A	2: 80,360,551 (GRCm39)	D533Y	probably damaging	Het
Ndufs2	T	C	1: 171,064,185 (GRCm39)	E375G	probably damaging	Het
Nsd1	T	C	13: 55,439,097 (GRCm39)	V1605A	probably damaging	Het
Or4k42	A	G	2: 111,320,464 (GRCm39)	I13T	probably benign	Het
Or52ae9	C	A	7: 103,389,994 (GRCm39)	R151L	probably damaging	Het
Or5ac17	T	A	16: 59,036,916 (GRCm39)	H20L	probably benign	Het
Or5b114-ps1	A	T	19: 13,352,647 (GRCm39)	Y107F	probably benign	Het
Or7e176	T	A	9: 20,171,754 (GRCm39)	M206K	probably benign	Het
Pcp2	G	A	8: 3,673,543 (GRCm39)		probably null	Het
Pdgfra	A	G	5: 75,334,057 (GRCm39)	S377G	probably damaging	Het
Reep5	A	T	18: 34,505,511 (GRCm39)	Y53*	probably null	Het
Ric1	T	C	19: 29,572,842 (GRCm39)	S761P	probably damaging	Het
Satb1	T	C	17: 52,082,404 (GRCm39)	T417A	possibly damaging	Het
Slc1a7	T	A	4: 107,859,379 (GRCm39)	M156K	possibly damaging	Het
Slc4a10	A	G	2: 62,041,789 (GRCm39)	E123G	probably damaging	Het
Slc66a1	A	G	4: 139,027,556 (GRCm39)	V262A	probably benign	Het
Snupn	C	A	9: 56,890,108 (GRCm39)	Q310K	possibly damaging	Het
Stard13	A	T	5: 150,965,707 (GRCm39)	V916E	probably damaging	Het
Tlr1	T	C	5: 65,082,556 (GRCm39)	R674G	possibly damaging	Het
Tnr	T	A	1: 159,714,692 (GRCm39)	V857E	probably benign	Het
Tubgcp5	A	G	7: 55,456,526 (GRCm39)	I373V	probably benign	Het
Ush2a	A	T	1: 188,090,160 (GRCm39)	R414S	possibly damaging	Het
Vmn2r100	T	C	17: 19,742,576 (GRCm39)	S317P	probably benign	Het
Wdr49	A	T	3: 75,230,989 (GRCm39)	F558I	probably benign	Het
Zfyve16	A	G	13: 92,648,105 (GRCm39)	I983T	probably benign	Het

Other mutations in Tnfsf11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02601:Tnfsf11	APN	14	78,537,385 (GRCm39)	nonsense	probably null
R0352:Tnfsf11	UTSW	14	78,516,408 (GRCm39)	missense	probably benign	0.17
R0377:Tnfsf11	UTSW	14	78,537,352 (GRCm39)	missense	probably benign	0.00
R2062:Tnfsf11	UTSW	14	78,516,362 (GRCm39)	missense	probably damaging	1.00
R2121:Tnfsf11	UTSW	14	78,537,333 (GRCm39)	missense	probably benign	0.32
R2178:Tnfsf11	UTSW	14	78,521,682 (GRCm39)	missense	probably benign	0.00
R2237:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2238:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2239:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2430:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4155:Tnfsf11	UTSW	14	78,537,309 (GRCm39)	missense	probably benign	0.28
R4197:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4562:Tnfsf11	UTSW	14	78,516,020 (GRCm39)	missense	probably damaging	1.00
R8063:Tnfsf11	UTSW	14	78,516,098 (GRCm39)	missense	probably damaging	1.00
R8904:Tnfsf11	UTSW	14	78,516,119 (GRCm39)	missense	possibly damaging	0.88
X0020:Tnfsf11	UTSW	14	78,516,317 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGCTCGAAAGTACAGGAAC -3'
(R):5'- ATAAGAGTTAGGGCTGCCTGG -3'

Sequencing Primer
(F):5'- ACAGAGCGATGCTGCAGACC -3'
(R):5'- TAGGGCTGCCTGGGGTAC -3'

Posted On

2018-05-02