Incidental Mutation 'R6407:Gab1'
ID514497
Institutional Source Beutler Lab
Gene Symbol Gab1
Ensembl Gene ENSMUSG00000031714
Gene Namegrowth factor receptor bound protein 2-associated protein 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_021356; MGI: 108088

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6407 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80764438-80880519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80788597 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 364 (R364L)
Ref Sequence ENSEMBL: ENSMUSP00000147784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034150] [ENSMUST00000210676]
Predicted Effect probably benign
Transcript: ENSMUST00000034150
AA Change: R364L

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034150
Gene: ENSMUSG00000031714
AA Change: R364L

DomainStartEndE-ValueType
PH 6 118 1.16e-23 SMART
low complexity region 336 354 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210676
AA Change: R364L

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211018
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the IRS1-like multisubstrate docking protein family. It is an important mediator of branching tubulogenesis and plays a central role in cellular growth response, transformation and apoptosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit developmental defects in the placenta, heart, eye, muscle, and skin, and die between embryonic day 13.5 and 18.5. [provided by MGI curators]
Allele List at MGI

All alleles(43) : Targeted, knock-out(1) Targeted, other(8) Gene trapped(34)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,293,811 S1122P probably benign Het
Alpk2 T C 18: 65,289,738 Y1963C probably benign Het
Bptf T A 11: 107,111,126 N387Y probably damaging Het
C1ql2 T C 1: 120,341,611 L165P probably damaging Het
Col5a2 C A 1: 45,376,778 C1403F probably damaging Het
Htr3a G T 9: 48,901,055 Y250* probably null Het
Ighg2c T C 12: 113,288,651 K94E unknown Het
Ighg3 T C 12: 113,360,150 N206S unknown Het
Il1f5 A G 2: 24,281,353 Y151C probably damaging Het
Kif22 G A 7: 127,033,203 R312C probably damaging Het
Lap3 T A 5: 45,511,925 V472E probably damaging Het
Mast3 T C 8: 70,782,128 T762A probably benign Het
Mfsd12 T C 10: 81,362,233 probably null Het
Mrpl39 T C 16: 84,732,385 K123R probably benign Het
Mup8 T A 4: 60,220,394 T113S possibly damaging Het
Nhp2 T C 11: 51,619,903 V29A probably benign Het
Olfr307 T C 7: 86,336,069 E109G possibly damaging Het
Pex3 T C 10: 13,546,368 R63G probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Rims2 T C 15: 39,452,328 S617P probably damaging Het
Rnf223 A T 4: 156,132,359 T64S probably damaging Het
Rrp12 C T 19: 41,883,742 V432M probably damaging Het
Sag T C 1: 87,814,806 V100A probably benign Het
Slc17a7 C T 7: 45,169,926 A167V probably benign Het
Slc38a6 T C 12: 73,310,175 F115S probably damaging Het
Spdye4a T C 5: 143,225,699 T37A probably benign Het
Sphk2 T C 7: 45,712,600 T138A possibly damaging Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Sult1a1 T C 7: 126,673,184 probably null Het
Tmem212 A G 3: 27,884,839 V166A probably benign Het
Tor4a A G 2: 25,194,940 L317P probably benign Het
Trim43c A T 9: 88,840,414 T38S probably benign Het
Tshz1 C A 18: 84,015,966 V106F possibly damaging Het
Yap1 A G 9: 7,962,372 M225T possibly damaging Het
Zcchc11 G T 4: 108,558,782 E1648D probably damaging Het
Zfp74 T C 7: 29,935,623 E220G probably damaging Het
Other mutations in Gab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01679:Gab1 APN 8 80791549 missense probably benign 0.00
IGL02610:Gab1 APN 8 80800099 critical splice donor site probably null
IGL02661:Gab1 APN 8 80788937 missense probably damaging 1.00
IGL02716:Gab1 APN 8 80769694 missense probably damaging 1.00
D3080:Gab1 UTSW 8 80766378 missense probably damaging 1.00
R0006:Gab1 UTSW 8 80769730 missense possibly damaging 0.56
R0144:Gab1 UTSW 8 80785201 splice site probably benign
R0173:Gab1 UTSW 8 80800160 missense possibly damaging 0.68
R0414:Gab1 UTSW 8 80800289 missense probably damaging 1.00
R0503:Gab1 UTSW 8 80800142 missense probably damaging 1.00
R0675:Gab1 UTSW 8 80769668 missense probably damaging 1.00
R0690:Gab1 UTSW 8 80800116 missense probably damaging 1.00
R1068:Gab1 UTSW 8 80800172 missense possibly damaging 0.95
R1175:Gab1 UTSW 8 80784842 missense probably damaging 0.99
R1240:Gab1 UTSW 8 80788530 missense probably damaging 1.00
R1430:Gab1 UTSW 8 80788612 missense probably benign 0.34
R1656:Gab1 UTSW 8 80788759 missense probably damaging 1.00
R1986:Gab1 UTSW 8 80766381 missense probably damaging 1.00
R2860:Gab1 UTSW 8 80784753 missense probably benign 0.32
R2861:Gab1 UTSW 8 80784753 missense probably benign 0.32
R4683:Gab1 UTSW 8 80788632 missense probably benign 0.34
R4726:Gab1 UTSW 8 80789053 missense possibly damaging 0.80
R5425:Gab1 UTSW 8 80800389 missense probably damaging 1.00
R5684:Gab1 UTSW 8 80769670 missense probably damaging 1.00
R6195:Gab1 UTSW 8 80879532 nonsense probably null
R6217:Gab1 UTSW 8 80791608 missense possibly damaging 0.48
R6233:Gab1 UTSW 8 80879532 nonsense probably null
R6408:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6415:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6418:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R6479:Gab1 UTSW 8 80788597 missense possibly damaging 0.77
R7019:Gab1 UTSW 8 80784817 missense probably damaging 0.99
R7291:Gab1 UTSW 8 80800151 missense probably damaging 1.00
R7432:Gab1 UTSW 8 80788669 missense probably benign 0.20
X0066:Gab1 UTSW 8 80879564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACTTGGGCAGAAAAGGCTC -3'
(R):5'- CGCAGATGAGACATGTATCCATC -3'

Sequencing Primer
(F):5'- CTTGGGCAGAAAAGGCTCTTACTC -3'
(R):5'- GAGACATGTATCCATCAGTTACGAC -3'
Posted On2018-05-04