Incidental Mutation 'R6408:Azi2'
ID514543
Institutional Source Beutler Lab
Gene Symbol Azi2
Ensembl Gene ENSMUSG00000039285
Gene Name5-azacytidine induced gene 2
SynonymsAZ2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118040499-118069794 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118061482 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 51 (R51*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044220] [ENSMUST00000044454] [ENSMUST00000133580] [ENSMUST00000134433] [ENSMUST00000135251] [ENSMUST00000154583] [ENSMUST00000215799]
Predicted Effect probably benign
Transcript: ENSMUST00000044220
SMART Domains Protein: ENSMUSP00000047904
Gene: ENSMUSG00000039163

DomainStartEndE-ValueType
Pfam:Cmc1 19 87 5.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044454
SMART Domains Protein: ENSMUSP00000044350
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 278 4.2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123690
AA Change: R51*
SMART Domains Protein: ENSMUSP00000121245
Gene: ENSMUSG00000039285
AA Change: R51*

DomainStartEndE-ValueType
Pfam:TBD 1 51 4.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130735
SMART Domains Protein: ENSMUSP00000114634
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 22 123 N/A INTRINSIC
Pfam:TBD 153 197 3.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133580
SMART Domains Protein: ENSMUSP00000118765
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 226 278 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133814
Predicted Effect probably benign
Transcript: ENSMUST00000134433
SMART Domains Protein: ENSMUSP00000114980
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 197 N/A INTRINSIC
Pfam:TBD 224 273 1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135251
SMART Domains Protein: ENSMUSP00000116971
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 20 50 N/A INTRINSIC
Pfam:TBD 77 131 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154583
SMART Domains Protein: ENSMUSP00000122063
Gene: ENSMUSG00000039285

DomainStartEndE-ValueType
coiled coil region 40 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215799
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AZI2, or NAP1, contributes to the activation of NFKB (see MIM 164011)-dependent gene expression by activating IKK-related kinases, such as NAK (TBK1; MIM 604834) (Fujita et al., 2003 [PubMed 14560022]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired GM-CSF-derived bone marrow-derived dendritic cell differenatiation, cytokine response and ability to stimulate T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Azi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03085:Azi2 APN 9 118059146 missense probably damaging 0.97
awry UTSW 9 118047419 start codon destroyed probably null 0.99
R0166:Azi2 UTSW 9 118055841 missense possibly damaging 0.82
R0636:Azi2 UTSW 9 118062057 missense probably benign 0.03
R2024:Azi2 UTSW 9 118049322 nonsense probably null
R3498:Azi2 UTSW 9 118049407 missense probably damaging 0.99
R3713:Azi2 UTSW 9 118047440 missense possibly damaging 0.65
R3899:Azi2 UTSW 9 118047503 missense probably damaging 1.00
R4765:Azi2 UTSW 9 118061471 unclassified probably benign
R5227:Azi2 UTSW 9 118047458 missense probably damaging 1.00
R5839:Azi2 UTSW 9 118059119 missense probably damaging 1.00
R5885:Azi2 UTSW 9 118047560 missense probably damaging 1.00
R6021:Azi2 UTSW 9 118047419 start codon destroyed probably null 0.99
R6276:Azi2 UTSW 9 118049338 missense probably damaging 0.96
R6525:Azi2 UTSW 9 118047595 missense probably damaging 0.96
R6889:Azi2 UTSW 9 118049895 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTGAACCCTCTCCCACTGAG -3'
(R):5'- GTCAGTCTTCTAGAAGTTGAGATTG -3'

Sequencing Primer
(F):5'- TGAGAAATTTCAGTAAGCCAAAGAAC -3'
(R):5'- CACTGGGAAATGGATTTGG -3'
Posted On2018-05-04