Incidental Mutation 'R6408:Shroom1'
ID514545
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Nameshroom family member 1
SynonymsShrm1, Apx, 1300007L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53457205-53467766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53463387 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 45 (T45P)
Ref Sequence ENSEMBL: ENSMUSP00000104641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000093114] [ENSMUST00000109013]
Predicted Effect probably benign
Transcript: ENSMUST00000018531
AA Change: T45P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: T45P

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093114
AA Change: T45P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: T45P

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109010
Predicted Effect probably benign
Transcript: ENSMUST00000109013
AA Change: T45P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: T45P

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155297
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53464094 missense probably benign 0.00
IGL00985:Shroom1 APN 11 53465969 missense probably benign
IGL01111:Shroom1 APN 11 53464048 missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53465558 missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53466559 missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53463379 missense probably benign
R0083:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0357:Shroom1 UTSW 11 53465208 missense probably damaging 0.96
R0661:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R1875:Shroom1 UTSW 11 53465675 missense probably damaging 0.99
R2356:Shroom1 UTSW 11 53466447 missense probably benign 0.05
R4657:Shroom1 UTSW 11 53465588 missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53466462 missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53465722 missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53465233 missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53465139 missense probably benign 0.07
R4964:Shroom1 UTSW 11 53465172 missense probably benign
R5000:Shroom1 UTSW 11 53467117 utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53464045 missense probably benign 0.00
R5141:Shroom1 UTSW 11 53463982 nonsense probably null
R5256:Shroom1 UTSW 11 53465507 missense probably benign 0.32
R5273:Shroom1 UTSW 11 53463844 missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53463922 missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53463991 missense probably benign 0.00
R6058:Shroom1 UTSW 11 53463481 missense possibly damaging 0.83
R6677:Shroom1 UTSW 11 53463516 missense possibly damaging 0.85
R7090:Shroom1 UTSW 11 53465933 missense probably damaging 1.00
R7369:Shroom1 UTSW 11 53465248 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGGTTGTCCTAGCCCTTACC -3'
(R):5'- TTTCGCTGGAAGGACGTCTC -3'

Sequencing Primer
(F):5'- GGTTGTCCTAGCCCTTACCTGAAC -3'
(R):5'- TTAGTGGTCCCGGGCTTCC -3'
Posted On2018-05-04