Incidental Mutation 'R6408:Polr3a'
ID514550
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 24486871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000224568] [ENSMUST00000225023]
Predicted Effect probably null
Transcript: ENSMUST00000026322
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112384
SMART Domains Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 23 108 4.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169826
SMART Domains Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290

DomainStartEndE-ValueType
Pfam:Ribosomal_S24e 24 102 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223939
Predicted Effect probably benign
Transcript: ENSMUST00000223999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224549
Predicted Effect probably benign
Transcript: ENSMUST00000224568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225014
Predicted Effect probably benign
Transcript: ENSMUST00000225023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225994
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7136:Polr3a UTSW 14 24461815 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACACTGTTCCGTCCATTG -3'
(R):5'- CTCTCTTCATAAAGTCCGGCGG -3'

Sequencing Primer
(F):5'- ATTGCACTTTCCCCGCTATAC -3'
(R):5'- TAAAGTCCGGCGGCGGAAG -3'
Posted On2018-05-04