Incidental Mutation 'R6408:Pus7l'
ID514557
Institutional Source Beutler Lab
Gene Symbol Pus7l
Ensembl Gene ENSMUSG00000033356
Gene Namepseudouridylate synthase 7-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location94522688-94543547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94531575 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 454 (M454T)
Ref Sequence ENSEMBL: ENSMUSP00000044075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049151]
Predicted Effect probably benign
Transcript: ENSMUST00000049151
AA Change: M454T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000044075
Gene: ENSMUSG00000033356
AA Change: M454T

DomainStartEndE-ValueType
Pfam:TruD 280 697 1e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147832
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Pus7l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Pus7l APN 15 94531612 missense probably benign 0.07
IGL02049:Pus7l APN 15 94540178 missense probably damaging 1.00
IGL02484:Pus7l APN 15 94529488 missense possibly damaging 0.70
IGL02731:Pus7l APN 15 94523464 missense probably benign 0.03
IGL03252:Pus7l APN 15 94525810 missense probably benign 0.00
IGL03392:Pus7l APN 15 94536568 missense probably damaging 1.00
R0638:Pus7l UTSW 15 94523417 missense probably benign 0.20
R0848:Pus7l UTSW 15 94540512 missense probably benign 0.16
R1646:Pus7l UTSW 15 94533636 missense probably benign 0.33
R1785:Pus7l UTSW 15 94540637 missense probably benign 0.04
R2046:Pus7l UTSW 15 94540785 missense probably benign 0.01
R2206:Pus7l UTSW 15 94523590 missense probably damaging 1.00
R2210:Pus7l UTSW 15 94540292 missense possibly damaging 0.95
R3618:Pus7l UTSW 15 94527907 missense probably damaging 0.97
R4485:Pus7l UTSW 15 94523490 missense probably benign 0.00
R4487:Pus7l UTSW 15 94531617 missense possibly damaging 0.46
R4686:Pus7l UTSW 15 94540211 missense probably damaging 1.00
R4739:Pus7l UTSW 15 94540710 missense probably benign 0.02
R4975:Pus7l UTSW 15 94529488 missense possibly damaging 0.70
R5431:Pus7l UTSW 15 94529486 missense probably damaging 1.00
R5567:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5570:Pus7l UTSW 15 94527865 missense probably benign 0.00
R5896:Pus7l UTSW 15 94529451 splice site probably null
R6681:Pus7l UTSW 15 94527865 missense probably benign 0.00
R7344:Pus7l UTSW 15 94540617 missense probably benign 0.01
X0065:Pus7l UTSW 15 94540773 missense possibly damaging 0.87
X0066:Pus7l UTSW 15 94529493 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ATCACTGGTCAGGTCTGTCTTC -3'
(R):5'- ACCTCCGTCTGTATTATTGGTG -3'

Sequencing Primer
(F):5'- AAGCTATTGTGTATACTCTGCTTTC -3'
(R):5'- CTCCGTCTGTATTATTGGTGATTAC -3'
Posted On2018-05-04