Incidental Mutation 'R6408:Robo1'
ID514559
Institutional Source Beutler Lab
Gene Symbol Robo1
Ensembl Gene ENSMUSG00000022883
Gene Nameroundabout guidance receptor 1
SynonymsDUTT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location72308306-73046095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72972046 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 500 (Y500H)
Ref Sequence ENSEMBL: ENSMUSP00000023600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023600]
Predicted Effect probably benign
Transcript: ENSMUST00000023600
AA Change: Y500H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000023600
Gene: ENSMUSG00000022883
AA Change: Y500H

DomainStartEndE-ValueType
IGc2 41 115 3.15e-10 SMART
IGc2 143 208 2.52e-9 SMART
IGc2 235 298 3.85e-14 SMART
IGv 328 391 3.71e-7 SMART
IGc2 428 493 2.46e-12 SMART
FN3 522 604 3.17e-13 SMART
FN3 634 721 1.66e0 SMART
FN3 736 822 4.28e-10 SMART
low complexity region 1108 1125 N/A INTRINSIC
low complexity region 1148 1157 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1249 1269 N/A INTRINSIC
low complexity region 1282 1298 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
low complexity region 1362 1380 N/A INTRINSIC
low complexity region 1442 1449 N/A INTRINSIC
low complexity region 1563 1576 N/A INTRINSIC
low complexity region 1602 1611 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000232205
AA Change: Y509H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232545
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a reporter allele show altered axon guidance. Mice homozygous for a null allele die at birth showing aberrant axon pathfinding and cortical interneuron migration. Homozygotes for another null allele show neonatal death, aphagia, delayed lung maturation and bronchial hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
Cyp4f16 T A 17: 32,551,199 L514Q probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Robo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01766:Robo1 APN 16 73004665 missense probably benign 0.00
IGL01937:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL01945:Robo1 APN 16 72962226 missense probably damaging 1.00
IGL02151:Robo1 APN 16 72989616 missense probably benign 0.00
IGL02232:Robo1 APN 16 72971984 missense possibly damaging 0.59
IGL02282:Robo1 APN 16 72742138 missense probably damaging 1.00
IGL02590:Robo1 APN 16 73043132 missense probably benign 0.06
IGL02874:Robo1 APN 16 73012918 missense probably damaging 0.96
IGL02974:Robo1 APN 16 73006862 missense probably benign 0.09
IGL03233:Robo1 APN 16 72970193 missense probably damaging 0.99
PIT4378001:Robo1 UTSW 16 73004535 missense probably damaging 1.00
R0079:Robo1 UTSW 16 72933342 splice site probably benign
R0254:Robo1 UTSW 16 72664170 missense probably benign 0.00
R0366:Robo1 UTSW 16 72742245 missense possibly damaging 0.52
R0410:Robo1 UTSW 16 72971984 missense possibly damaging 0.59
R0511:Robo1 UTSW 16 73013125 critical splice donor site probably null
R0563:Robo1 UTSW 16 72972286 missense probably benign 0.01
R0637:Robo1 UTSW 16 73001951 missense probably benign 0.29
R1239:Robo1 UTSW 16 73024542 splice site probably null
R1773:Robo1 UTSW 16 73004511 missense probably benign 0.00
R1777:Robo1 UTSW 16 73004667 missense probably benign
R1901:Robo1 UTSW 16 72960204 missense probably null 1.00
R1902:Robo1 UTSW 16 72960204 missense probably null 1.00
R1903:Robo1 UTSW 16 72960204 missense probably null 1.00
R1996:Robo1 UTSW 16 72970179 missense probably benign 0.40
R2040:Robo1 UTSW 16 72933742 missense probably damaging 1.00
R2266:Robo1 UTSW 16 72978772 missense probably benign
R2269:Robo1 UTSW 16 72978772 missense probably benign
R2433:Robo1 UTSW 16 72970239 missense probably benign 0.01
R3084:Robo1 UTSW 16 73004737 missense probably benign 0.02
R3085:Robo1 UTSW 16 73002010 missense possibly damaging 0.81
R3150:Robo1 UTSW 16 72970269 missense possibly damaging 0.57
R3418:Robo1 UTSW 16 73035917 missense probably benign 0.00
R3610:Robo1 UTSW 16 72983770 missense probably benign 0.00
R3940:Robo1 UTSW 16 73009743 missense probably benign
R3953:Robo1 UTSW 16 73024338 missense probably damaging 1.00
R4692:Robo1 UTSW 16 72960202 missense probably damaging 1.00
R4726:Robo1 UTSW 16 72972043 missense probably damaging 1.00
R4814:Robo1 UTSW 16 72972035 missense probably benign 0.11
R4884:Robo1 UTSW 16 72904751 missense probably damaging 1.00
R4992:Robo1 UTSW 16 72979868 missense probably damaging 0.98
R5150:Robo1 UTSW 16 72972304 missense possibly damaging 0.79
R5183:Robo1 UTSW 16 72742150 missense probably benign 0.03
R5360:Robo1 UTSW 16 72935777 missense probably damaging 0.96
R5629:Robo1 UTSW 16 72983710 missense probably benign 0.33
R5804:Robo1 UTSW 16 73043189 critical splice donor site probably null
R6107:Robo1 UTSW 16 72983829 missense probably benign 0.00
R6127:Robo1 UTSW 16 73013068 missense probably benign
R6128:Robo1 UTSW 16 73013068 missense probably benign
R6129:Robo1 UTSW 16 73013068 missense probably benign
R6191:Robo1 UTSW 16 72933808 missense probably benign 0.00
R6357:Robo1 UTSW 16 72970302 missense probably benign 0.00
R6516:Robo1 UTSW 16 73024353 missense probably benign 0.14
R6600:Robo1 UTSW 16 72989655 missense probably damaging 1.00
R6802:Robo1 UTSW 16 72933313 missense probably benign 0.17
R7105:Robo1 UTSW 16 72742161 missense probably damaging 1.00
R7189:Robo1 UTSW 16 72960151 nonsense probably null
R7290:Robo1 UTSW 16 73004520 missense probably benign 0.03
R7296:Robo1 UTSW 16 72989631 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGCATTTCTGGTTCAAAG -3'
(R):5'- TGACATCTGTAACTTCGGGC -3'

Sequencing Primer
(F):5'- TTTTCCAGCCCAGAAAGG -3'
(R):5'- GGTTGAACTGGAACCCCAAATTC -3'
Posted On2018-05-04