Incidental Mutation 'R6408:Cyp4f16'
ID514560
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6408 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32536558-32551798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32551199 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 514 (L514Q)
Ref Sequence ENSEMBL: ENSMUSP00000131058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
Predicted Effect probably damaging
Transcript: ENSMUST00000003416
AA Change: L514Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440
AA Change: L514Q

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165515
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168346
Predicted Effect probably benign
Transcript: ENSMUST00000169252
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169591
AA Change: L514Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440
AA Change: L514Q

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.2%
Validation Efficiency 94% (45/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T C 5: 107,543,992 S50P probably damaging Het
4930407I10Rik T C 15: 82,065,106 V1068A possibly damaging Het
Acss1 A G 2: 150,628,492 probably null Het
Amer2 T C 14: 60,380,225 I497T probably damaging Het
Azi2 A T 9: 118,061,482 R51* probably null Het
BC005561 A G 5: 104,518,777 I388M probably benign Het
Brdt A G 5: 107,385,492 D946G probably damaging Het
Bzw2 C T 12: 36,107,525 V314I possibly damaging Het
Capn13 A T 17: 73,365,959 Y116* probably null Het
Clca4b A G 3: 144,919,275 I485T probably benign Het
Crybg3 T A 16: 59,495,690 T1130S possibly damaging Het
Cubn C T 2: 13,294,203 V3220M probably damaging Het
D7Ertd443e G T 7: 134,349,711 Q31K probably benign Het
Dcaf15 T C 8: 84,104,726 E8G probably benign Het
Ddx24 A C 12: 103,425,560 probably benign Het
Diaph3 T C 14: 86,828,994 M988V possibly damaging Het
Dlx4 A G 11: 95,145,252 V77A probably benign Het
Dnah3 T C 7: 119,922,968 probably null Het
Drc1 A G 5: 30,356,288 E396G probably benign Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gbp2b T C 3: 142,618,138 L568S probably benign Het
Gjb5 A T 4: 127,356,147 F68Y probably benign Het
Gm17359 A G 3: 79,449,399 R170G probably benign Het
Gm9008 A G 6: 76,496,458 C392R probably damaging Het
Hs6st3 C A 14: 119,138,634 P74T probably benign Het
Kif26b T C 1: 178,917,568 L1743P probably damaging Het
Lnx1 A T 5: 74,685,646 C48S probably damaging Het
Lrfn2 A G 17: 49,070,626 H245R probably damaging Het
Lrrc27 A G 7: 139,218,268 E93G probably benign Het
Mettl6 T C 14: 31,479,726 E253G probably damaging Het
Nmu A T 5: 76,343,971 F106Y probably damaging Het
Pcsk7 T C 9: 45,909,696 I142T probably benign Het
Polr3a A T 14: 24,486,871 probably null Het
Psmb9 G T 17: 34,185,733 A19E probably damaging Het
Pus7l A G 15: 94,531,575 M454T probably benign Het
Raet1e A G 10: 22,180,746 T74A probably benign Het
Ralb A C 1: 119,478,109 Y43* probably null Het
Ralgapa1 C A 12: 55,683,910 E1947* probably null Het
Robo1 T C 16: 72,972,046 Y500H probably benign Het
Shroom1 A C 11: 53,463,387 T45P probably benign Het
Slit2 A G 5: 47,984,986 probably benign Het
Srgap3 T C 6: 112,723,006 S1004G probably damaging Het
Taok2 A G 7: 126,870,992 V888A probably benign Het
Tbc1d8 T A 1: 39,402,899 D204V probably damaging Het
Trav7d-4 C A 14: 52,770,167 A39D probably damaging Het
Ush2a G T 1: 188,267,032 E180* probably null Het
Vmn1r37 A G 6: 66,731,579 D63G probably benign Het
Zfp282 G A 6: 47,880,385 R184Q probably damaging Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1422:Cyp4f16 UTSW 17 32542999 missense probably damaging 0.99
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R2200:Cyp4f16 UTSW 17 32537104 missense probably damaging 0.98
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4837:Cyp4f16 UTSW 17 32542764 missense possibly damaging 0.59
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7463:Cyp4f16 UTSW 17 32550787 missense possibly damaging 0.89
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTAGGCACTGCACAGAG -3'
(R):5'- ACTCTTCATCAGTCTGCAGGC -3'

Sequencing Primer
(F):5'- TGCACAGAGTCCCCATCCTG -3'
(R):5'- CAGAAAGGCCCTTGGACTCAG -3'
Posted On2018-05-04