Incidental Mutation 'R6410:Arhgap24'
ID514574
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 044383-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6410 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102892151 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 411 (I411N)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably benign
Transcript: ENSMUST00000070000
AA Change: I321N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: I321N

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: I411N

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: I411N

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 133,062,899 R484W probably damaging Het
Armt1 A G 10: 4,453,826 S304G probably benign Het
Atg9b T A 5: 24,386,110 N774I possibly damaging Het
C1s1 C T 6: 124,531,158 C624Y probably damaging Het
Camsap2 C A 1: 136,345,444 probably benign Het
Cd109 T C 9: 78,657,516 S248P probably benign Het
Cd28 A T 1: 60,765,283 H140L probably benign Het
Csmd3 G A 15: 48,673,407 T133I probably damaging Het
D430041D05Rik A T 2: 104,168,203 probably null Het
Defb47 T C 14: 63,000,993 V56A probably benign Het
Fxyd5 T C 7: 31,035,406 E132G probably damaging Het
H2-M2 A G 17: 37,483,213 V40A probably damaging Het
H2-Q7 T C 17: 35,440,176 L201P probably benign Het
Klra9 T G 6: 130,178,994 D266A probably damaging Het
Meioc A G 11: 102,675,034 N492S probably benign Het
Mgea5 T C 19: 45,776,045 probably null Het
Nmt2 A G 2: 3,316,178 E341G probably damaging Het
Nutm1 A C 2: 112,248,729 V947G possibly damaging Het
Olfr873 T A 9: 20,300,452 I84N probably damaging Het
Pm20d1 G A 1: 131,798,596 G57D probably benign Het
Pnpla5 A G 15: 84,120,679 I157T probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sv2b A T 7: 75,140,109 I392N probably benign Het
Wfdc8 T A 2: 164,597,743 I240F probably benign Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACCATGGGTCAGTTGCAGAAC -3'
(R):5'- AGAATACCCATGCGGACAGTG -3'

Sequencing Primer
(F):5'- TGGGTCAGTTGCAGAACAAAGAAAAC -3'
(R):5'- GAGTGCCCATTTTGGTACCAGAAC -3'
Posted On2018-05-04