Incidental Mutation 'R6410:Arhgap24'
ID 514574
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene Name Rho GTPase activating protein 24
Synonyms 0610025G21Rik
MMRRC Submission 044383-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 102629257-103045803 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103040017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 411 (I411N)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070000
AA Change: I321N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: I321N

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: I411N

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: I411N

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: I318N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: I318N

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahdc1 C T 4: 132,790,210 (GRCm39) R484W probably damaging Het
Armt1 A G 10: 4,403,826 (GRCm39) S304G probably benign Het
Atg9b T A 5: 24,591,108 (GRCm39) N774I possibly damaging Het
C1s1 C T 6: 124,508,117 (GRCm39) C624Y probably damaging Het
Camsap2 C A 1: 136,273,182 (GRCm39) probably benign Het
Cd109 T C 9: 78,564,798 (GRCm39) S248P probably benign Het
Cd28 A T 1: 60,804,442 (GRCm39) H140L probably benign Het
Csmd3 G A 15: 48,536,803 (GRCm39) T133I probably damaging Het
D430041D05Rik A T 2: 103,998,548 (GRCm39) probably null Het
Defb47 T C 14: 63,238,442 (GRCm39) V56A probably benign Het
Fxyd5 T C 7: 30,734,831 (GRCm39) E132G probably damaging Het
H2-M2 A G 17: 37,794,104 (GRCm39) V40A probably damaging Het
H2-Q7 T C 17: 35,659,152 (GRCm39) L201P probably benign Het
Klra9 T G 6: 130,155,957 (GRCm39) D266A probably damaging Het
Meioc A G 11: 102,565,860 (GRCm39) N492S probably benign Het
Nmt2 A G 2: 3,317,215 (GRCm39) E341G probably damaging Het
Nutm1 A C 2: 112,079,074 (GRCm39) V947G possibly damaging Het
Oga T C 19: 45,764,484 (GRCm39) probably null Het
Or7e177 T A 9: 20,211,748 (GRCm39) I84N probably damaging Het
Pm20d1 G A 1: 131,726,334 (GRCm39) G57D probably benign Het
Pnpla5 A G 15: 84,004,880 (GRCm39) I157T probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Sv2b A T 7: 74,789,857 (GRCm39) I392N probably benign Het
Wfdc8 T A 2: 164,439,663 (GRCm39) I240F probably benign Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 103,008,265 (GRCm39) missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 103,008,243 (GRCm39) missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 103,040,386 (GRCm39) missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 103,023,552 (GRCm39) splice site probably benign
bullmarket UTSW 5 103,023,643 (GRCm39) missense probably damaging 0.99
buyers UTSW 5 103,045,086 (GRCm39) missense probably damaging 1.00
wallstreet UTSW 5 102,700,163 (GRCm39) splice site probably null
BB009:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
BB019:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
R0506:Arhgap24 UTSW 5 103,023,643 (GRCm39) missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 103,045,086 (GRCm39) missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102,811,972 (GRCm39) missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 103,008,198 (GRCm39) missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 103,039,953 (GRCm39) missense probably benign 0.40
R2112:Arhgap24 UTSW 5 103,040,366 (GRCm39) missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 103,008,291 (GRCm39) missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 103,039,776 (GRCm39) missense probably benign
R3803:Arhgap24 UTSW 5 103,040,308 (GRCm39) missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102,811,983 (GRCm39) missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102,812,080 (GRCm39) intron probably benign
R5045:Arhgap24 UTSW 5 103,039,743 (GRCm39) missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102,989,201 (GRCm39) missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 103,040,015 (GRCm39) missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102,994,037 (GRCm39) critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102,700,025 (GRCm39) splice site probably null
R6039:Arhgap24 UTSW 5 103,028,652 (GRCm39) missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 103,028,652 (GRCm39) missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 103,040,778 (GRCm39) missense probably benign 0.12
R6450:Arhgap24 UTSW 5 103,044,990 (GRCm39) missense probably benign 0.01
R6520:Arhgap24 UTSW 5 103,028,659 (GRCm39) missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102,700,163 (GRCm39) splice site probably null
R7233:Arhgap24 UTSW 5 103,026,367 (GRCm39) missense probably benign 0.03
R7311:Arhgap24 UTSW 5 103,040,551 (GRCm39) missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 103,040,212 (GRCm39) missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102,989,174 (GRCm39) missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102,993,882 (GRCm39) intron probably benign
R7667:Arhgap24 UTSW 5 103,026,323 (GRCm39) missense probably benign
R7932:Arhgap24 UTSW 5 102,993,835 (GRCm39) intron probably benign
R8227:Arhgap24 UTSW 5 103,023,647 (GRCm39) missense probably benign 0.02
R8289:Arhgap24 UTSW 5 103,028,692 (GRCm39) missense possibly damaging 0.88
R8431:Arhgap24 UTSW 5 103,040,464 (GRCm39) missense possibly damaging 0.49
R8721:Arhgap24 UTSW 5 103,023,565 (GRCm39) missense possibly damaging 0.46
R8767:Arhgap24 UTSW 5 103,039,740 (GRCm39) missense probably benign
R8954:Arhgap24 UTSW 5 103,040,136 (GRCm39) missense probably benign 0.00
R9120:Arhgap24 UTSW 5 103,040,016 (GRCm39) missense probably benign 0.05
R9306:Arhgap24 UTSW 5 102,994,008 (GRCm39) missense possibly damaging 0.91
R9687:Arhgap24 UTSW 5 102,994,022 (GRCm39) missense probably benign
Z1176:Arhgap24 UTSW 5 103,028,673 (GRCm39) missense probably benign 0.00
Z1176:Arhgap24 UTSW 5 103,023,625 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCATGGGTCAGTTGCAGAAC -3'
(R):5'- AGAATACCCATGCGGACAGTG -3'

Sequencing Primer
(F):5'- TGGGTCAGTTGCAGAACAAAGAAAAC -3'
(R):5'- GAGTGCCCATTTTGGTACCAGAAC -3'
Posted On 2018-05-04