Incidental Mutation 'R6411:Dennd4a'
ID514603
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission 044384-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R6411 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64871899 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 555 (R555G)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: R555G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: R555G

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Capn7 A G 14: 31,340,096 E55G probably benign Het
Carmil2 G T 8: 105,697,026 D1211Y probably damaging Het
Carns1 G T 19: 4,166,464 A573E probably damaging Het
Guf1 T C 5: 69,560,511 I204T possibly damaging Het
Hgsnat C T 8: 25,946,275 V584M possibly damaging Het
Izumo2 A T 7: 44,719,760 Q186L probably benign Het
Lmtk2 A T 5: 144,174,586 Q708L probably damaging Het
Mitf T C 6: 98,010,472 probably null Het
Myo9b T A 8: 71,322,955 Y340* probably null Het
Naip5 A G 13: 100,223,405 I441T probably benign Het
Nbea A C 3: 55,805,357 S2100A probably benign Het
Olfr1130 G T 2: 87,607,973 C195F probably damaging Het
Olfr1441 G A 19: 12,422,986 V226I probably benign Het
Olfr328 T A 11: 58,551,657 Y194F probably damaging Het
Olfr449 A G 6: 42,838,720 T280A possibly damaging Het
Oxnad1 C G 14: 32,091,652 H3Q possibly damaging Het
Rab8b A T 9: 66,854,666 probably null Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Safb2 A G 17: 56,571,289 S24P probably benign Het
Sele G A 1: 164,049,415 V87I probably benign Het
Slc8b1 T A 5: 120,521,126 W212R probably damaging Het
Vmn1r88 A T 7: 13,178,043 I109F probably damaging Het
Zfp758 A T 17: 22,375,094 D155V possibly damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 intron probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAACAGAACCTCAAAGTGATAGGG -3'
(R):5'- TGTGCTTTGCTGAATACGGAC -3'

Sequencing Primer
(F):5'- CTTGGGGTTTGCATACTATGAAG -3'
(R):5'- TGCTGAATACGGACTATTAGGTCAG -3'
Posted On2018-05-04