Mutagenetix > Incidental Mutation

Incidental Mutation 'R6412:Lct'

514614

Institutional Source

Beutler Lab

Gene Symbol

Lct

Ensembl Gene

ENSMUSG00000026354

Gene Name

lactase

Synonyms

LPH, LOC226413, Lphl

MMRRC Submission

044385-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6412 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128212493-128256055 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128255455 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 196 (T196A)

Ref Sequence

ENSEMBL: ENSMUSP00000073190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027601] [ENSMUST00000073490] [ENSMUST00000190495]

AlphaFold

F8VPT3

Predicted Effect

probably benign
Transcript: ENSMUST00000027601

SMART Domains

Protein: ENSMUSP00000027601
Gene: ENSMUSG00000026355

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	821	1e-47	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000073490
AA Change: T196A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: T196A

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	76	226	1.6e-19	PFAM
low complexity region	322	340	N/A	INTRINSIC
Pfam:Glyco_hydro_1	380	849	4.8e-169	PFAM
low complexity region	865	875	N/A	INTRINSIC
Pfam:Glyco_hydro_1	902	1368	3.7e-181	PFAM
Pfam:Glyco_hydro_1	1377	1844	6.9e-183	PFAM
transmembrane domain	1885	1907	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190495

SMART Domains

Protein: ENSMUSP00000140308
Gene: ENSMUSG00000026355

Domain	Start	End	E-Value	Type
MCM	119	657	1.43e-270	SMART
PDB:2LE8\|A	710	783	3e-29	PDB

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	A	G	9: 107,807,116 (GRCm39)	I480V	probably benign	Het
BC025920	T	C	10: 81,445,195 (GRCm39)	V106A	probably benign	Het
Bhlhe23	A	G	2: 180,417,963 (GRCm39)	F192L	possibly damaging	Het
Cftr	C	T	6: 18,285,603 (GRCm39)	T1137I	probably damaging	Het
Chst8	T	C	7: 34,375,504 (GRCm39)	M112V	probably benign	Het
Cilk1	T	C	9: 78,047,258 (GRCm39)	S53P	probably damaging	Het
Fbxw26	T	A	9: 109,561,715 (GRCm39)	M160L	probably damaging	Het
Gm3264	A	G	14: 16,058,238 (GRCm39)	K81R	probably damaging	Het
Htr3b	T	C	9: 48,857,819 (GRCm39)	N141S	possibly damaging	Het
Itgb2l	T	C	16: 96,228,929 (GRCm39)	S425G	probably benign	Het
Kbtbd12	T	C	6: 88,595,638 (GRCm39)	E64G	probably damaging	Het
Luzp2	T	C	7: 54,707,794 (GRCm39)	S61P	probably damaging	Het
Or4b1b	G	T	2: 90,112,202 (GRCm39)	A239D	probably damaging	Het
Or5l14	A	T	2: 87,792,693 (GRCm39)	L181Q	probably damaging	Het
Rag1	A	G	2: 101,472,865 (GRCm39)	V759A	probably damaging	Het
Ret	C	T	6: 118,161,245 (GRCm39)	R77H	probably benign	Het
Rsrc1	C	T	3: 66,901,982 (GRCm39)	P44L	unknown	Het
Sbno1	T	C	5: 124,530,777 (GRCm39)	T840A	probably damaging	Het
Skic2	A	G	17: 35,059,276 (GRCm39)	V1057A	possibly damaging	Het
Spocd1	C	T	4: 129,847,365 (GRCm39)	S518L	probably benign	Het
Thbs2	A	C	17: 14,897,339 (GRCm39)	L723R	probably damaging	Het
Vmn1r223	G	T	13: 23,433,825 (GRCm39)	V140F	probably benign	Het
Vmn2r52	A	G	7: 9,904,936 (GRCm39)	V301A	probably benign	Het
Vwf	T	C	6: 125,656,279 (GRCm39)	F2615L	probably benign	Het
Wdr81	G	T	11: 75,341,989 (GRCm39)	P1093T	probably benign	Het
Xdh	T	C	17: 74,242,902 (GRCm39)	E135G	probably benign	Het
Zfp990	C	A	4: 145,264,138 (GRCm39)	P379T	probably benign	Het

Other mutations in Lct

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Lct	APN	1	128,215,293 (GRCm39)	missense	probably benign	0.09
IGL00970:Lct	APN	1	128,231,805 (GRCm39)	missense	probably damaging	1.00
IGL01022:Lct	APN	1	128,228,596 (GRCm39)	missense	probably benign
IGL01878:Lct	APN	1	128,222,003 (GRCm39)	missense	probably damaging	1.00
IGL01892:Lct	APN	1	128,235,342 (GRCm39)	missense	probably damaging	1.00
IGL02307:Lct	APN	1	128,214,327 (GRCm39)	missense	possibly damaging	0.70
IGL02434:Lct	APN	1	128,231,527 (GRCm39)	missense	probably damaging	0.97
IGL02559:Lct	APN	1	128,222,003 (GRCm39)	missense	probably damaging	1.00
IGL02623:Lct	APN	1	128,235,988 (GRCm39)	missense	probably benign	0.01
IGL02818:Lct	APN	1	128,227,905 (GRCm39)	missense	probably damaging	1.00
IGL02949:Lct	APN	1	128,240,869 (GRCm39)	missense	probably benign	0.26
IGL02951:Lct	APN	1	128,227,948 (GRCm39)	missense	probably damaging	1.00
IGL03087:Lct	APN	1	128,228,112 (GRCm39)	missense	possibly damaging	0.81
IGL03227:Lct	APN	1	128,255,426 (GRCm39)	missense	probably benign	0.09
ANU18:Lct	UTSW	1	128,235,784 (GRCm39)	nonsense	probably null
R0071:Lct	UTSW	1	128,219,755 (GRCm39)	nonsense	probably null
R0071:Lct	UTSW	1	128,219,755 (GRCm39)	nonsense	probably null
R0135:Lct	UTSW	1	128,212,860 (GRCm39)	missense	probably damaging	0.98
R0145:Lct	UTSW	1	128,255,632 (GRCm39)	missense	probably benign	0.00
R0179:Lct	UTSW	1	128,255,422 (GRCm39)	missense	probably benign
R0331:Lct	UTSW	1	128,226,479 (GRCm39)	splice site	probably benign
R0366:Lct	UTSW	1	128,214,199 (GRCm39)	missense	probably benign	0.03
R0399:Lct	UTSW	1	128,228,262 (GRCm39)	missense	probably damaging	1.00
R0492:Lct	UTSW	1	128,228,319 (GRCm39)	missense	probably damaging	1.00
R0548:Lct	UTSW	1	128,212,932 (GRCm39)	missense	probably damaging	1.00
R0691:Lct	UTSW	1	128,235,971 (GRCm39)	missense	probably benign	0.00
R0755:Lct	UTSW	1	128,221,872 (GRCm39)	missense	possibly damaging	0.46
R0839:Lct	UTSW	1	128,214,346 (GRCm39)	missense	probably benign	0.00
R1128:Lct	UTSW	1	128,229,046 (GRCm39)	missense	probably damaging	0.99
R1135:Lct	UTSW	1	128,221,861 (GRCm39)	critical splice donor site	probably null
R1321:Lct	UTSW	1	128,227,759 (GRCm39)	missense	probably benign
R1448:Lct	UTSW	1	128,235,559 (GRCm39)	missense	probably damaging	0.99
R1450:Lct	UTSW	1	128,235,640 (GRCm39)	missense	probably damaging	1.00
R1572:Lct	UTSW	1	128,221,932 (GRCm39)	missense	probably benign	0.25
R1582:Lct	UTSW	1	128,228,299 (GRCm39)	missense	probably damaging	1.00
R1668:Lct	UTSW	1	128,215,459 (GRCm39)	splice site	probably null
R1757:Lct	UTSW	1	128,228,994 (GRCm39)	missense	probably damaging	1.00
R1775:Lct	UTSW	1	128,228,038 (GRCm39)	missense	probably damaging	1.00
R1792:Lct	UTSW	1	128,255,679 (GRCm39)	missense	possibly damaging	0.54
R1815:Lct	UTSW	1	128,227,896 (GRCm39)	missense	probably damaging	1.00
R1932:Lct	UTSW	1	128,221,898 (GRCm39)	missense	probably damaging	1.00
R2325:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R2381:Lct	UTSW	1	128,231,858 (GRCm39)	nonsense	probably null
R3001:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3002:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3003:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3011:Lct	UTSW	1	128,229,109 (GRCm39)	missense	possibly damaging	0.74
R3082:Lct	UTSW	1	128,215,345 (GRCm39)	missense	probably damaging	1.00
R3683:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3684:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3726:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3886:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3887:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R3888:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4019:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4027:Lct	UTSW	1	128,212,918 (GRCm39)	missense	probably benign	0.00
R4226:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4409:Lct	UTSW	1	128,231,963 (GRCm39)	missense	probably damaging	1.00
R4514:Lct	UTSW	1	128,228,251 (GRCm39)	missense	probably benign
R4570:Lct	UTSW	1	128,227,641 (GRCm39)	missense	probably benign	0.01
R4776:Lct	UTSW	1	128,228,124 (GRCm39)	missense	probably damaging	0.99
R5001:Lct	UTSW	1	128,235,978 (GRCm39)	missense	probably damaging	0.96
R5021:Lct	UTSW	1	128,228,302 (GRCm39)	missense	probably benign	0.38
R5318:Lct	UTSW	1	128,232,109 (GRCm39)	missense	probably damaging	1.00
R5330:Lct	UTSW	1	128,226,266 (GRCm39)	missense	probably benign	0.06
R5385:Lct	UTSW	1	128,239,354 (GRCm39)	missense	possibly damaging	0.63
R5499:Lct	UTSW	1	128,214,414 (GRCm39)	missense	probably damaging	1.00
R5508:Lct	UTSW	1	128,221,868 (GRCm39)	missense	probably damaging	1.00
R5642:Lct	UTSW	1	128,222,969 (GRCm39)	missense	probably damaging	1.00
R5724:Lct	UTSW	1	128,228,073 (GRCm39)	missense	probably benign
R6026:Lct	UTSW	1	128,227,755 (GRCm39)	missense	probably benign
R6044:Lct	UTSW	1	128,235,717 (GRCm39)	missense	possibly damaging	0.95
R6175:Lct	UTSW	1	128,255,451 (GRCm39)	missense	probably damaging	1.00
R6277:Lct	UTSW	1	128,231,974 (GRCm39)	missense	probably benign	0.01
R6480:Lct	UTSW	1	128,222,057 (GRCm39)	missense	probably damaging	1.00
R6526:Lct	UTSW	1	128,228,215 (GRCm39)	missense	probably benign	0.05
R6620:Lct	UTSW	1	128,222,809 (GRCm39)	critical splice donor site	probably null
R7214:Lct	UTSW	1	128,228,197 (GRCm39)	missense	probably benign	0.00
R7308:Lct	UTSW	1	128,246,824 (GRCm39)	missense	probably benign	0.00
R7577:Lct	UTSW	1	128,228,469 (GRCm39)	missense	probably damaging	0.99
R7626:Lct	UTSW	1	128,212,932 (GRCm39)	missense	probably damaging	1.00
R7737:Lct	UTSW	1	128,226,430 (GRCm39)	missense	probably benign	0.12
R7901:Lct	UTSW	1	128,216,722 (GRCm39)	missense	probably benign	0.44
R8033:Lct	UTSW	1	128,212,996 (GRCm39)	missense	probably benign	0.03
R8373:Lct	UTSW	1	128,231,577 (GRCm39)	missense	probably damaging	1.00
R8504:Lct	UTSW	1	128,215,306 (GRCm39)	missense	probably damaging	1.00
R8751:Lct	UTSW	1	128,221,534 (GRCm39)	missense	probably benign	0.18
R8781:Lct	UTSW	1	128,215,261 (GRCm39)	missense	probably damaging	1.00
R8797:Lct	UTSW	1	128,231,684 (GRCm39)	missense	possibly damaging	0.77
R8926:Lct	UTSW	1	128,228,148 (GRCm39)	missense	probably damaging	1.00
R8949:Lct	UTSW	1	128,221,929 (GRCm39)	missense	probably damaging	1.00
R8992:Lct	UTSW	1	128,228,299 (GRCm39)	missense	probably damaging	1.00
R9138:Lct	UTSW	1	128,227,894 (GRCm39)	missense	probably benign	0.03
R9260:Lct	UTSW	1	128,227,704 (GRCm39)	nonsense	probably null
R9416:Lct	UTSW	1	128,228,329 (GRCm39)	missense	possibly damaging	0.74
R9531:Lct	UTSW	1	128,235,598 (GRCm39)	missense	probably benign	0.00
X0052:Lct	UTSW	1	128,235,367 (GRCm39)	missense	probably damaging	1.00
YA93:Lct	UTSW	1	128,229,057 (GRCm39)	missense	probably damaging	1.00
Z1176:Lct	UTSW	1	128,215,348 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCCTTTGGAAATGTTCACATTAC -3'
(R):5'- TGAAGGATGCCCAGCTTCAG -3'

Sequencing Primer
(F):5'- CAGATTCTCAGCAGTGCTTAGATCTG -3'
(R):5'- GTGGTCCTGTTCCACCAGATG -3'

Posted On

2018-05-04