Incidental Mutation 'R6412:Bhlhe23'
ID 514618
Institutional Source Beutler Lab
Gene Symbol Bhlhe23
Ensembl Gene ENSMUSG00000045493
Gene Name basic helix-loop-helix family, member e23
Synonyms beta-cell E-box transactivating factor 4, A930001L02Rik, BETA4, Bhlhb4
MMRRC Submission 044385-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R6412 (G1)
Quality Score 166.009
Status Not validated
Chromosome 2
Chromosomal Location 180416174-180418693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180417963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 192 (F192L)
Ref Sequence ENSEMBL: ENSMUSP00000104506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108878]
AlphaFold Q8BGW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000108878
AA Change: F192L

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104506
Gene: ENSMUSG00000045493
AA Change: F192L

DomainStartEndE-ValueType
low complexity region 61 102 N/A INTRINSIC
HLH 104 158 4.07e-15 SMART
low complexity region 168 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154524
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix transcription factor family. Members of this family contain two highly conserved and functionally distinct domains: the basic domain targets sequence-specific DNA binding, while the helix-loop-helix domain facilitates protein interaction. Studies of a related gene in mouse suggest that the encoded protein may function as a transcriptional repressor in the pancreas and brain, and that it is required for normal retinal function. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display a severe deficit in retinal activity characterized by improper retinal rod bipolar cell maturation, loss of the scotopic ERG b-wave, and a significant increase in inner nuclear layer (INL) cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 A G 9: 107,807,116 (GRCm39) I480V probably benign Het
BC025920 T C 10: 81,445,195 (GRCm39) V106A probably benign Het
Cftr C T 6: 18,285,603 (GRCm39) T1137I probably damaging Het
Chst8 T C 7: 34,375,504 (GRCm39) M112V probably benign Het
Cilk1 T C 9: 78,047,258 (GRCm39) S53P probably damaging Het
Fbxw26 T A 9: 109,561,715 (GRCm39) M160L probably damaging Het
Gm3264 A G 14: 16,058,238 (GRCm39) K81R probably damaging Het
Htr3b T C 9: 48,857,819 (GRCm39) N141S possibly damaging Het
Itgb2l T C 16: 96,228,929 (GRCm39) S425G probably benign Het
Kbtbd12 T C 6: 88,595,638 (GRCm39) E64G probably damaging Het
Lct T C 1: 128,255,455 (GRCm39) T196A probably benign Het
Luzp2 T C 7: 54,707,794 (GRCm39) S61P probably damaging Het
Or4b1b G T 2: 90,112,202 (GRCm39) A239D probably damaging Het
Or5l14 A T 2: 87,792,693 (GRCm39) L181Q probably damaging Het
Rag1 A G 2: 101,472,865 (GRCm39) V759A probably damaging Het
Ret C T 6: 118,161,245 (GRCm39) R77H probably benign Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Sbno1 T C 5: 124,530,777 (GRCm39) T840A probably damaging Het
Skic2 A G 17: 35,059,276 (GRCm39) V1057A possibly damaging Het
Spocd1 C T 4: 129,847,365 (GRCm39) S518L probably benign Het
Thbs2 A C 17: 14,897,339 (GRCm39) L723R probably damaging Het
Vmn1r223 G T 13: 23,433,825 (GRCm39) V140F probably benign Het
Vmn2r52 A G 7: 9,904,936 (GRCm39) V301A probably benign Het
Vwf T C 6: 125,656,279 (GRCm39) F2615L probably benign Het
Wdr81 G T 11: 75,341,989 (GRCm39) P1093T probably benign Het
Xdh T C 17: 74,242,902 (GRCm39) E135G probably benign Het
Zfp990 C A 4: 145,264,138 (GRCm39) P379T probably benign Het
Other mutations in Bhlhe23
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5212:Bhlhe23 UTSW 2 180,417,886 (GRCm39) missense probably damaging 0.99
R6765:Bhlhe23 UTSW 2 180,418,136 (GRCm39) missense probably damaging 0.99
R8939:Bhlhe23 UTSW 2 180,418,099 (GRCm39) missense probably damaging 0.99
R9209:Bhlhe23 UTSW 2 180,418,143 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGCTTTCTCAGACGGAC -3'
(R):5'- CGCAAGCTCTCCAAGATAGC -3'

Sequencing Primer
(F):5'- CCAACAGTTCTGTAAGCGGAGTAC -3'
(R):5'- AGATAGCCACACTTCTGCTGG -3'
Posted On 2018-05-04