Incidental Mutation 'R6387:Pfas'
ID514667
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6387 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69000465 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 269 (F269L)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably damaging
Transcript: ENSMUST00000021282
AA Change: F269L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: F269L

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172987
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,015 K326E possibly damaging Het
Acot1 A G 12: 84,009,853 D115G probably benign Het
Adm T C 7: 110,628,295 I6T possibly damaging Het
Ahi1 A G 10: 20,969,043 Y349C probably damaging Het
Aldh1a1 A G 19: 20,617,959 E84G probably damaging Het
Ankrd31 A G 13: 96,830,573 D520G probably damaging Het
Ano4 A T 10: 88,971,405 Y736* probably null Het
Atp6v1a A G 16: 44,087,443 F612S possibly damaging Het
Calcb G A 7: 114,719,790 V17I possibly damaging Het
Cfap70 C T 14: 20,448,575 V15M probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Csgalnact1 C T 8: 68,358,713 G435D probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eprs T A 1: 185,387,084 M487K possibly damaging Het
Fat4 A G 3: 38,983,785 E3862G probably damaging Het
Gdf10 T A 14: 33,924,004 S37T probably benign Het
Hhatl T A 9: 121,790,401 H39L probably benign Het
Icam4 A C 9: 21,030,209 S215R possibly damaging Het
Ighv1-18 T C 12: 114,682,660 E108G probably damaging Het
Iqcd T C 5: 120,606,855 I416T probably benign Het
Marf1 T A 16: 14,141,640 *577L probably null Het
Mark2 A G 19: 7,285,902 F167L probably damaging Het
Mpdz T C 4: 81,381,709 T351A possibly damaging Het
Mrps27 A G 13: 99,400,317 I113V possibly damaging Het
Numbl C T 7: 27,276,690 T265I probably damaging Het
Obsl1 C T 1: 75,491,362 A1296T probably benign Het
Olfr979 A G 9: 40,000,852 I125T probably damaging Het
Pcdhb21 A G 18: 37,515,332 I505V probably benign Het
Prkdc G A 16: 15,698,815 V1018I probably benign Het
Prl4a1 T A 13: 28,018,499 V19E possibly damaging Het
Ptpn22 A G 3: 103,885,386 D327G probably benign Het
Smad3 G T 9: 63,654,765 D310E probably benign Het
Sparcl1 T A 5: 104,085,060 D625V probably damaging Het
Spta1 G A 1: 174,231,333 A1945T probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sympk T C 7: 19,052,498 Y1009H possibly damaging Het
Trio A G 15: 27,752,739 F1026L probably damaging Het
Uhrf1bp1l C T 10: 89,803,057 Q442* probably null Het
Unc5d T A 8: 28,875,526 K144* probably null Het
Unk A G 11: 116,054,940 N479S possibly damaging Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zfp993 A G 4: 146,657,518 T100A probably damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7386:Pfas UTSW 11 69003774 missense probably benign
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- CTCACCTGTGGGGAAGTTATG -3'
(R):5'- GTTGGGAAGATGCAGCACTG -3'

Sequencing Primer
(F):5'- GTCTCTGCTGTGAAGACAACATG -3'
(R):5'- ACTGAGGTGACCATGTACCTC -3'
Posted On2018-05-04