Incidental Mutation 'R6409:Zfp106'
ID514764
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6409 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120532104 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 79 (S79T)
Ref Sequence ENSEMBL: ENSMUSP00000126939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect probably damaging
Transcript: ENSMUST00000055241
AA Change: S868T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: S868T

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135625
AA Change: S79T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288
AA Change: S79T

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect probably benign
Transcript: ENSMUST00000163384
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171215
AA Change: S845T

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: S845T

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 97% (32/33)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G A 7: 131,262,071 probably benign Het
Aatk G T 11: 120,011,732 Q556K probably benign Het
Adgrf3 A G 5: 30,197,314 V572A probably damaging Het
Ahnak G A 19: 9,009,574 V2741M probably benign Het
Ascc3 T C 10: 50,845,580 V2043A probably benign Het
B3glct C T 5: 149,735,451 R239C probably benign Het
Cacna2d4 T A 6: 119,282,228 V626E probably damaging Het
Cfap54 T C 10: 92,967,492 N1563D probably benign Het
Duox2 G C 2: 122,284,667 H1110D probably damaging Het
Gm12794 C T 4: 101,940,677 Q91* probably null Het
Inppl1 A T 7: 101,828,961 F648I probably damaging Het
Mefv C A 16: 3,710,793 probably null Het
Ms4a4b T C 19: 11,461,360 probably null Het
Mtus2 T C 5: 148,077,615 V406A probably benign Het
Nup88 T C 11: 70,944,972 R554G probably null Het
Olfr1098 A T 2: 86,923,171 Y120* probably null Het
Olfr1425 C T 19: 12,074,747 probably benign Het
Olfr54 A G 11: 51,027,188 Y62C probably damaging Het
Pde10a A G 17: 8,949,438 D246G probably damaging Het
Pmm1 T C 15: 81,960,807 T9A probably benign Het
Psg18 T C 7: 18,353,521 M71V probably benign Het
Rapgef4 A G 2: 72,178,237 H253R probably benign Het
Rfc4 T C 16: 23,114,073 *371W probably null Het
Rgs18 T A 1: 144,775,193 K17* probably null Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sertm1 T C 3: 54,899,367 Y79C probably benign Het
Sfrp1 T C 8: 23,417,378 I198T possibly damaging Het
Slc15a2 T A 16: 36,761,870 I254F probably benign Het
Slc29a4 A G 5: 142,712,071 D93G probably damaging Het
Smo T C 6: 29,736,114 L35S unknown Het
Tbc1d8 A G 1: 39,372,588 S1056P probably benign Het
Ttll9 A G 2: 152,999,341 D286G probably damaging Het
Vmn2r14 A G 5: 109,216,230 Y607H probably benign Het
Vps8 T A 16: 21,478,439 C564S probably benign Het
Zc3h12d A G 10: 7,867,318 H284R probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
proton UTSW 2 120510534 missense probably damaging 1.00
quark UTSW 2 120535060 nonsense probably null
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1755:Zfp106 UTSW 2 120535175 missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R1932:Zfp106 UTSW 2 120531681 missense possibly damaging 0.80
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3875:Zfp106 UTSW 2 120534613 missense probably benign 0.08
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 unclassified probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 unclassified probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R6765:Zfp106 UTSW 2 120539454 missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGCTGTCTTCTGACTCTGG -3'
(R):5'- TTCTTGACAGCAGGAGCCTC -3'

Sequencing Primer
(F):5'- TTCTGACTCTGGGCAGCAC -3'
(R):5'- TCTGTGCAGGAGAGCCTAG -3'
Posted On2018-05-04