Incidental Mutation 'R6413:1110017D15Rik'
List |< first << previous [record 22 of 55675] next >> last >|
ID514804
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41505135 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 196 (V196D)
Ref Sequence ENSEMBL: ENSMUSP00000092744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000054920] [ENSMUST00000095126] [ENSMUST00000149596]
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054920
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095126
AA Change: V196D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441
AA Change: V196D

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124019
Predicted Effect silent
Transcript: ENSMUST00000125303
SMART Domains Protein: ENSMUSP00000122537
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 176 5.2e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138217
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Tmem176b T C 6: 48,838,332 N9S possibly damaging Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R5132:1110017D15Rik UTSW 4 41517178 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- ACTCGGGCGTGTCTGAAATG -3'
(R):5'- TCCCAGGGCTTTATACAAAGGG -3'

Sequencing Primer
(F):5'- GGGGTGGGTTTCCTTATCTCATACAG -3'
(R):5'- GCTTTATACAAAGGGTAAGAGGTC -3'
Posted On2018-05-04