Incidental Mutation 'R6413:Tmem176b'
ID514813
Institutional Source Beutler Lab
Gene Symbol Tmem176b
Ensembl Gene ENSMUSG00000029810
Gene Nametransmembrane protein 176B
Synonyms1810009M01Rik, Clast1, Lr8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6413 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48833818-48841496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48838332 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 9 (N9S)
Ref Sequence ENSEMBL: ENSMUSP00000144949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101426] [ENSMUST00000101429] [ENSMUST00000164733] [ENSMUST00000166247] [ENSMUST00000168406] [ENSMUST00000203229] [ENSMUST00000203265] [ENSMUST00000203355] [ENSMUST00000203501] [ENSMUST00000203639] [ENSMUST00000204073] [ENSMUST00000204309] [ENSMUST00000204400] [ENSMUST00000204482] [ENSMUST00000204783] [ENSMUST00000205147] [ENSMUST00000205159]
Predicted Effect probably benign
Transcript: ENSMUST00000101426
SMART Domains Protein: ENSMUSP00000098969
Gene: ENSMUSG00000023367

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.7e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101429
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098972
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164733
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128705
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 224 5.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166247
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131064
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168406
SMART Domains Protein: ENSMUSP00000131775
Gene: ENSMUSG00000023367

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 2.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203229
AA Change: N9S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144865
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203265
AA Change: N9S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144869
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 194 2.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203355
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145395
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203461
Predicted Effect possibly damaging
Transcript: ENSMUST00000203501
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144742
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 170 3.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203618
Predicted Effect probably benign
Transcript: ENSMUST00000203639
SMART Domains Protein: ENSMUSP00000145250
Gene: ENSMUSG00000023367

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.4e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204073
AA Change: N9S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144864
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 224 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204309
Predicted Effect probably benign
Transcript: ENSMUST00000204400
Predicted Effect probably benign
Transcript: ENSMUST00000204482
SMART Domains Protein: ENSMUSP00000145101
Gene: ENSMUSG00000023367

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:CD20 63 223 8.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204783
SMART Domains Protein: ENSMUSP00000144810
Gene: ENSMUSG00000029810

DomainStartEndE-ValueType
Pfam:CD20 1 58 1.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205147
AA Change: N9S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145235
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 195 2.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205159
AA Change: N9S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144949
Gene: ENSMUSG00000029810
AA Change: N9S

DomainStartEndE-ValueType
Pfam:CD20 60 196 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit severe sporadic ataxia and a small cerebellum associated with abnormal cerebellar lobulation, loss of the internal granule cell layer, poor formation of the external germinal layer, and disorganized Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A T 4: 41,505,135 V196D possibly damaging Het
3110070M22Rik C A 13: 119,488,111 probably benign Het
Agtpbp1 A G 13: 59,500,020 V662A possibly damaging Het
Ambra1 T G 2: 91,769,084 V183G possibly damaging Het
Amdhd2 A G 17: 24,158,316 S208P probably damaging Het
Ankdd1a C T 9: 65,510,372 V133I probably benign Het
Ankrd35 A G 3: 96,684,813 K805R probably damaging Het
Arhgap28 T C 17: 67,875,588 Q270R probably benign Het
Cabp2 G A 19: 4,085,698 probably null Het
Ccnt1 A G 15: 98,543,969 S473P probably benign Het
Cenpt G A 8: 105,846,341 P373S possibly damaging Het
Cyp3a44 T A 5: 145,794,444 D182V probably damaging Het
Ddx54 A G 5: 120,627,062 T799A probably benign Het
Dtna T A 18: 23,622,014 D464E probably damaging Het
E030025P04Rik T C 11: 109,139,599 Y154C unknown Het
Ephb2 C A 4: 136,771,122 E215D probably benign Het
Eya4 T C 10: 23,116,826 D445G probably damaging Het
Flg2 A T 3: 93,220,376 L2198F unknown Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klhl22 T C 16: 17,789,317 F496L probably benign Het
Numa1 A T 7: 101,990,571 probably null Het
Papola T C 12: 105,806,504 probably benign Het
Phldb1 T C 9: 44,696,143 E1255G probably damaging Het
Rgs8 A T 1: 153,692,873 D168V probably damaging Het
Rlf A G 4: 121,147,325 V1486A probably damaging Het
Rpa2 G T 4: 132,773,845 A118S probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Serpina1f T A 12: 103,693,694 I110F probably damaging Het
Serpini2 T C 3: 75,259,614 Y112C probably damaging Het
Sh2b3 A G 5: 121,828,923 Y43H probably damaging Het
Shank2 A G 7: 144,410,218 E514G probably damaging Het
Slc44a5 T C 3: 154,257,750 F388S probably benign Het
Trip11 T A 12: 101,885,531 Q758L probably benign Het
Trrap T A 5: 144,784,046 I231N possibly damaging Het
Ttn A T 2: 76,900,053 probably benign Het
Vmn2r68 T C 7: 85,221,765 N770S probably damaging Het
Vmn2r73 A T 7: 85,870,336 Y471* probably null Het
Vmn2r8 T G 5: 108,801,723 E419D probably benign Het
Wdfy4 C A 14: 32,967,647 L2818F probably damaging Het
Zfhx4 A T 3: 5,243,145 Y477F probably damaging Het
Other mutations in Tmem176b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Tmem176b APN 6 48834070 missense possibly damaging 0.79
IGL02374:Tmem176b APN 6 48834626 missense possibly damaging 0.60
IGL03027:Tmem176b APN 6 48835639 missense probably damaging 1.00
IGL03134:Tmem176b UTSW 6 48838353 missense probably benign 0.00
R1634:Tmem176b UTSW 6 48834566 missense probably damaging 1.00
R1920:Tmem176b UTSW 6 48838204 missense possibly damaging 0.70
R2008:Tmem176b UTSW 6 48835449 missense probably damaging 0.97
R2056:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2057:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R2059:Tmem176b UTSW 6 48836333 missense probably damaging 0.97
R5099:Tmem176b UTSW 6 48834529 missense probably benign
R5484:Tmem176b UTSW 6 48834533 missense probably benign 0.01
R5623:Tmem176b UTSW 6 48834070 missense probably benign 0.14
R6102:Tmem176b UTSW 6 48835934 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCTATCCAAGATGGGAGTCTCC -3'
(R):5'- GGCTCTACAAGTGGTTTGGATC -3'

Sequencing Primer
(F):5'- AAGATGGGAGTCTCCACCCTC -3'
(R):5'- TGGATCTTCAATCAGGGCCAC -3'
Posted On2018-05-04