Incidental Mutation 'R6414:Zranb3'
ID514836
Institutional Source Beutler Lab
Gene Symbol Zranb3
Ensembl Gene ENSMUSG00000036086
Gene Namezinc finger, RAN-binding domain containing 3
Synonyms4933425L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location127954184-128103047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128040957 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 74 (Y74H)
Ref Sequence ENSEMBL: ENSMUSP00000108157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086614] [ENSMUST00000112538]
Predicted Effect probably benign
Transcript: ENSMUST00000086614
AA Change: Y74H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000083806
Gene: ENSMUSG00000036086
AA Change: Y74H

DomainStartEndE-ValueType
DEXDc 33 214 3.37e-19 SMART
HELICc 352 435 3.79e-13 SMART
ZnF_RBZ 619 643 6.93e-5 SMART
HNHc 985 1036 5.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097597
SMART Domains Protein: ENSMUSP00000095204
Gene: ENSMUSG00000036086

DomainStartEndE-ValueType
DEXDc 33 214 3.37e-19 SMART
HELICc 352 435 3.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112538
AA Change: Y74H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108157
Gene: ENSMUSG00000036086
AA Change: Y74H

DomainStartEndE-ValueType
Pfam:SNF2_N 40 98 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127393
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Other mutations in Zranb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Zranb3 APN 1 128016140 missense probably benign 0.01
IGL00818:Zranb3 APN 1 128032867 missense probably damaging 1.00
IGL01360:Zranb3 APN 1 127959885 nonsense probably null
IGL01704:Zranb3 APN 1 127967939 missense possibly damaging 0.93
IGL02131:Zranb3 APN 1 127992951 missense probably damaging 1.00
IGL02466:Zranb3 APN 1 128016092 missense probably benign 0.08
IGL02825:Zranb3 APN 1 127959752 missense probably benign 0.13
IGL02836:Zranb3 APN 1 127960825 missense probably benign 0.00
R0088:Zranb3 UTSW 1 127976462 missense probably benign
R0279:Zranb3 UTSW 1 127963773 missense probably benign 0.01
R0423:Zranb3 UTSW 1 128091870 missense probably damaging 1.00
R0499:Zranb3 UTSW 1 127955080 splice site probably null
R0562:Zranb3 UTSW 1 128036558 missense probably benign 0.04
R0972:Zranb3 UTSW 1 127956646 missense probably damaging 1.00
R1480:Zranb3 UTSW 1 128091862 missense probably damaging 1.00
R1552:Zranb3 UTSW 1 127960751 splice site probably benign
R1704:Zranb3 UTSW 1 128092003 start codon destroyed probably null 0.22
R1817:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1818:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1819:Zranb3 UTSW 1 128017556 critical splice donor site probably null
R1951:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1953:Zranb3 UTSW 1 127999399 missense probably damaging 1.00
R1988:Zranb3 UTSW 1 127959743 missense probably benign
R2011:Zranb3 UTSW 1 128091901 missense probably benign 0.00
R3159:Zranb3 UTSW 1 127972949 missense probably benign
R4179:Zranb3 UTSW 1 127960864 missense possibly damaging 0.88
R4281:Zranb3 UTSW 1 127963877 missense possibly damaging 0.69
R4400:Zranb3 UTSW 1 127956655 missense possibly damaging 0.87
R5236:Zranb3 UTSW 1 128040989 missense probably damaging 1.00
R5330:Zranb3 UTSW 1 127959720 missense probably damaging 0.99
R5719:Zranb3 UTSW 1 127963876 missense probably benign 0.00
R6125:Zranb3 UTSW 1 127959745 missense probably benign
R6220:Zranb3 UTSW 1 127999404 missense probably benign 0.44
R6751:Zranb3 UTSW 1 127959819 missense probably benign
R7229:Zranb3 UTSW 1 128040893 missense probably benign 0.00
R7419:Zranb3 UTSW 1 127963851 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAGCCCTGAGTTTTGTCATTAGTAC -3'
(R):5'- TTCCACCTAGGGATCATCTGTC -3'

Sequencing Primer
(F):5'- GTCATTAGTACCAAAAAGTCAAAAGC -3'
(R):5'- GACTCTTAACATTCCTAATGATCTT -3'
Posted On2018-05-04