Incidental Mutation 'R6414:Gata3'
ID514840
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene NameGATA binding protein 3
SynonymsGata-3, jal
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location9857078-9890034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9858434 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 423 (H423L)
Ref Sequence ENSEMBL: ENSMUSP00000100041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976]
PDB Structure
Adjacent GATA DNA binding [X-RAY DIFFRACTION]
Opposite GATA DNA binding [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102976
AA Change: H423L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: H423L

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151456
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0724:Gata3 UTSW 2 9874575 missense probably benign
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1576:Gata3 UTSW 2 9863196 missense probably damaging 0.98
R1608:Gata3 UTSW 2 9874768 nonsense probably null
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5040:Gata3 UTSW 2 9858515 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6696:Gata3 UTSW 2 9874492 nonsense probably null
R6848:Gata3 UTSW 2 9858528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CACAGATCTGTCGCTTTCGG -3'
(R):5'- AGATTAACAGACCCCTGACTATGAAG -3'

Sequencing Primer
(F):5'- TCGGGCTTCATGATACTGC -3'
(R):5'- CCCTGACTATGAAGAAAGAAGGCATC -3'
Posted On2018-05-04