Incidental Mutation 'R6414:Olfr1275'
ID514842
Institutional Source Beutler Lab
Gene Symbol Olfr1275
Ensembl Gene ENSMUSG00000074966
Gene Nameolfactory receptor 1275
SynonymsGA_x6K02T2Q125-72283260-72282322, MOR245-18
MMRRC Submission
Accession Numbers

Genbank: NM_001011795; MGI: 3031109

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111230360-111235286 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 111231152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028577] [ENSMUST00000099620] [ENSMUST00000216421] [ENSMUST00000217539]
Predicted Effect probably null
Transcript: ENSMUST00000028577
SMART Domains Protein: ENSMUSP00000028577
Gene: ENSMUSG00000027157

DomainStartEndE-ValueType
ANK 78 107 1.61e-4 SMART
ANK 111 140 3.6e-2 SMART
ANK 144 173 4.89e-4 SMART
ANK 177 206 4.03e-5 SMART
ANK 210 239 8.72e-1 SMART
Blast:ANK 243 272 4e-12 BLAST
low complexity region 460 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099620
AA Change: L214V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097215
Gene: ENSMUSG00000074966
AA Change: L214V

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 9.8e-37 PFAM
Pfam:7tm_1 41 287 5.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216421
AA Change: L214V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217539
AA Change: L214V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Olfr1275
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Olfr1275 UTSW 2 111231463 missense possibly damaging 0.77
R0477:Olfr1275 UTSW 2 111231664 missense probably benign 0.00
R1209:Olfr1275 UTSW 2 111231613 missense probably damaging 1.00
R1780:Olfr1275 UTSW 2 111231698 missense probably benign
R5386:Olfr1275 UTSW 2 111231194 missense probably benign 0.05
R5637:Olfr1275 UTSW 2 111231111 missense probably benign 0.26
R5819:Olfr1275 UTSW 2 111230959 missense probably damaging 1.00
R6007:Olfr1275 UTSW 2 111230930 missense probably benign 0.30
R6557:Olfr1275 UTSW 2 111231631 missense probably benign 0.01
R6864:Olfr1275 UTSW 2 111231197 missense probably benign 0.26
R7035:Olfr1275 UTSW 2 111231439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAAAATGGCCAGGAACTTATC -3'
(R):5'- ACCCACGGATGTGTCTTTTG -3'

Sequencing Primer
(F):5'- CACAGTAGGAAATGGCCA -3'
(R):5'- CTCATTCATTCAGTGGCTCAATTAG -3'
Posted On2018-05-04