Incidental Mutation 'R6414:Snta1'
ID514843
Institutional Source Beutler Lab
Gene Symbol Snta1
Ensembl Gene ENSMUSG00000027488
Gene Namesyntrophin, acidic 1
Synonymsalpha1-syntrophin, Snt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location154376313-154408099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 154378067 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 391 (T391S)
Ref Sequence ENSEMBL: ENSMUSP00000028991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028991] [ENSMUST00000109728]
PDB Structure
Unexpected Modes of PDZ Domain Scaffolding Revealed by Structure of NNOS-Syntrophin Complex [X-RAY DIFFRACTION]
Solution structure of the PDZ domain of alpha-syntrophin [SOLUTION NMR]
solution structure of the split PH-PDZ Supramodule of alpha-Syntrophin [SOLUTION NMR]
solution structure of the joined PH domain of alpha1-syntrophin [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SYNTROPHIN PDZ DOMAIN IN COMPLEX WITH THE PEPTIDE GVKESLV, NMR, 15 STRUCTURES [SOLUTION NMR]
Crystal structure of the computationally designed NNOS-Syntrophin complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028991
AA Change: T391S

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028991
Gene: ENSMUSG00000027488
AA Change: T391S

DomainStartEndE-ValueType
PH 7 265 1.24e0 SMART
PDZ 90 164 1.88e-19 SMART
PH 288 401 1.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109728
AA Change: T387S

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105350
Gene: ENSMUSG00000027488
AA Change: T387S

DomainStartEndE-ValueType
PH 7 265 1.24e0 SMART
PDZ 90 164 1.88e-19 SMART
PH 288 397 1.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntrophins are cytoplasmic peripheral membrane scaffold proteins that are components of the dystrophin-associated protein complex. This gene is a member of the syntrophin gene family and encodes the most common syntrophin isoform found in cardiac tissues. The N-terminal PDZ domain of this syntrophin protein interacts with the C-terminus of the pore-forming alpha subunit (SCN5A) of the cardiac sodium channel Nav1.5. This protein also associates cardiac sodium channels with the nitric oxide synthase-PMCA4b (plasma membrane Ca-ATPase subtype 4b) complex in cardiomyocytes. This gene is a susceptibility locus for Long-QT syndrome (LQT) - an inherited disorder associated with sudden cardiac death from arrhythmia - and sudden infant death syndrome (SIDS). This protein also associates with dystrophin and dystrophin-related proteins at the neuromuscular junction and alters intracellular calcium ion levels in muscle tissue. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted null allele display impaired astrocyte and neuromuscular synapse morphology. Mice homozygous for another targeted null allele show neither gross histological abnormalities in skeletal muscle nor significant changes in muscle contractile properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Snta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Snta1 APN 2 154381039 missense probably benign
R0080:Snta1 UTSW 2 154383837 missense probably benign 0.02
R0631:Snta1 UTSW 2 154377072 missense probably benign 0.00
R0760:Snta1 UTSW 2 154380940 missense probably damaging 0.97
R1545:Snta1 UTSW 2 154377006 critical splice donor site probably null
R4584:Snta1 UTSW 2 154378115 missense probably benign 0.00
R4910:Snta1 UTSW 2 154377018 nonsense probably null
R5330:Snta1 UTSW 2 154378020 nonsense probably null
R6180:Snta1 UTSW 2 154377182 missense probably benign 0.03
R6468:Snta1 UTSW 2 154377149 missense probably damaging 0.99
R7070:Snta1 UTSW 2 154381059 missense probably benign
R7394:Snta1 UTSW 2 154376860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCCCAGAGCATCTGCATAC -3'
(R):5'- GAAGGATGCAGGTCTTTGCC -3'

Sequencing Primer
(F):5'- GCATCTGCATACCCCAGATAGGG -3'
(R):5'- CAGGTCTTTGCCCCGGC -3'
Posted On2018-05-04