Incidental Mutation 'R6414:Slc25a3'
ID514872
Institutional Source Beutler Lab
Gene Symbol Slc25a3
Ensembl Gene ENSMUSG00000061904
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 3
Synonyms5730556H19Rik, Phc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6414 (G1)
Quality Score172.009
Status Validated
Chromosome10
Chromosomal Location91116574-91124059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91122328 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 50 (Q50P)
Ref Sequence ENSEMBL: ENSMUSP00000129301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076694] [ENSMUST00000163246] [ENSMUST00000164505] [ENSMUST00000170810]
Predicted Effect probably benign
Transcript: ENSMUST00000076694
SMART Domains Protein: ENSMUSP00000075987
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103979
Predicted Effect possibly damaging
Transcript: ENSMUST00000163246
AA Change: Q50P

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129301
Gene: ENSMUSG00000061904
AA Change: Q50P

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164505
SMART Domains Protein: ENSMUSP00000132480
Gene: ENSMUSG00000061904

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 58 147 3.9e-23 PFAM
Pfam:Mito_carr 156 243 4.8e-19 PFAM
Pfam:Mito_carr 254 338 3.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169339
Predicted Effect probably benign
Transcript: ENSMUST00000170810
AA Change: Q50P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127098
Gene: ENSMUSG00000061904
AA Change: Q50P

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
Pfam:Mito_carr 59 147 8.6e-21 PFAM
Pfam:Mito_carr 157 245 4.4e-19 PFAM
Pfam:Mito_carr 255 339 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172442
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the transport of phosphate into the mitochondrial matrix, either by proton cotransport or in exchange for hydroxyl ions. The protein contains three related segments arranged in tandem which are related to those found in other characterized members of the mitochondrial carrier family. Both the N-terminal and C-terminal regions of this protein protrude toward the cytosol. Multiple alternatively spliced transcript variants have been isolated. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Slc25a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01702:Slc25a3 APN 10 91118125 missense probably damaging 0.96
IGL02193:Slc25a3 APN 10 91118115 missense probably benign 0.01
R1215:Slc25a3 UTSW 10 91117308 missense possibly damaging 0.95
R4737:Slc25a3 UTSW 10 91122188 missense possibly damaging 0.66
R5418:Slc25a3 UTSW 10 91119536 missense probably benign
R5799:Slc25a3 UTSW 10 91122041 missense probably benign
R6228:Slc25a3 UTSW 10 91122228 missense probably damaging 0.98
R6269:Slc25a3 UTSW 10 91117101 nonsense probably null
R6866:Slc25a3 UTSW 10 91119705 missense probably damaging 0.99
R7404:Slc25a3 UTSW 10 91117040 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGTTTCCACACAGCTTGTTAGTAG -3'
(R):5'- CTGATTTGACAGTGACTTTCATGTC -3'

Sequencing Primer
(F):5'- CACACAGCTTGTTAGTAGCAGTC -3'
(R):5'- GTGGCTAAAGCTGCATAC -3'
Posted On2018-05-04