Incidental Mutation 'R6414:Chd3'
ID 514876
Institutional Source Beutler Lab
Gene Symbol Chd3
Ensembl Gene ENSMUSG00000018474
Gene Name chromodomain helicase DNA binding protein 3
Synonyms 2600010P09Rik, Mi-2 alpha, Chd7, Prp7, Prp9-1
MMRRC Submission 044556-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6414 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69234099-69260232 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 69243371 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092971] [ENSMUST00000108661]
AlphaFold B1AR17
Predicted Effect probably null
Transcript: ENSMUST00000092971
SMART Domains Protein: ENSMUSP00000090649
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 199 253 1.4e-34 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1754 1926 8.6e-104 PFAM
low complexity region 1935 1967 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108661
SMART Domains Protein: ENSMUSP00000104301
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 148 180 N/A INTRINSIC
Pfam:CHDNT 200 253 4.3e-29 PFAM
low complexity region 257 283 N/A INTRINSIC
low complexity region 285 308 N/A INTRINSIC
low complexity region 345 360 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
PHD 434 477 1.54e-14 SMART
RING 435 476 4.25e-1 SMART
PHD 510 553 1.74e-13 SMART
RING 511 552 3.93e0 SMART
CHROMO 558 637 7.23e-14 SMART
CHROMO 681 730 2.85e-12 SMART
low complexity region 749 755 N/A INTRINSIC
DEXDc 784 996 1.64e-31 SMART
low complexity region 1107 1125 N/A INTRINSIC
HELICc 1142 1226 2.61e-25 SMART
low complexity region 1290 1303 N/A INTRINSIC
DUF1087 1345 1409 2.98e-33 SMART
DUF1086 1415 1571 1.79e-109 SMART
low complexity region 1573 1602 N/A INTRINSIC
low complexity region 1672 1685 N/A INTRINSIC
Pfam:CHDCT2 1789 1960 4.9e-93 PFAM
low complexity region 1969 2001 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122992
Predicted Effect probably null
Transcript: ENSMUST00000128981
SMART Domains Protein: ENSMUSP00000122137
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 55 87 N/A INTRINSIC
Pfam:CHDNT 107 160 3.9e-29 PFAM
low complexity region 164 190 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
low complexity region 305 321 N/A INTRINSIC
PHD 341 384 1.54e-14 SMART
RING 342 383 4.25e-1 SMART
PHD 417 460 1.74e-13 SMART
RING 418 459 3.93e0 SMART
CHROMO 465 544 7.23e-14 SMART
CHROMO 588 637 2.85e-12 SMART
low complexity region 656 662 N/A INTRINSIC
DEXDc 691 903 1.64e-31 SMART
low complexity region 1014 1032 N/A INTRINSIC
HELICc 1049 1133 2.61e-25 SMART
low complexity region 1197 1210 N/A INTRINSIC
DUF1087 1252 1316 2.98e-33 SMART
DUF1086 1322 1478 1.79e-109 SMART
low complexity region 1480 1509 N/A INTRINSIC
low complexity region 1579 1592 N/A INTRINSIC
Pfam:CHDCT2 1662 1833 4.4e-93 PFAM
low complexity region 1842 1874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144332
Predicted Effect probably benign
Transcript: ENSMUST00000151436
SMART Domains Protein: ENSMUSP00000118172
Gene: ENSMUSG00000018474

DomainStartEndE-ValueType
Pfam:SNF2_N 1 142 9e-24 PFAM
SCOP:d1gkub2 162 197 1e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157256
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CHD family of proteins which are characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. This protein is one of the components of a histone deacetylase complex referred to as the Mi-2/NuRD complex which participates in the remodeling of chromatin by deacetylating histones. Chromatin remodeling is essential for many processes including transcription. Autoantibodies against this protein are found in a subset of patients with dermatomyositis. Three alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T A 4: 144,503,985 (GRCm39) I389L possibly damaging Het
Acap1 A G 11: 69,775,162 (GRCm39) V367A probably benign Het
Alpk1 T C 3: 127,473,858 (GRCm39) D715G probably benign Het
Atg101 T A 15: 101,188,341 (GRCm39) C149S probably benign Het
Atp2c1 A T 9: 105,343,855 (GRCm39) I84N probably damaging Het
Ceacam20 C A 7: 19,710,056 (GRCm39) A360E probably damaging Het
Clcc1 G A 3: 108,584,167 (GRCm39) C517Y possibly damaging Het
Col6a5 T C 9: 105,769,465 (GRCm39) probably null Het
Ctnna3 T C 10: 64,096,644 (GRCm39) V394A probably benign Het
Ctsll3 A G 13: 60,948,113 (GRCm39) F188S probably damaging Het
Cyth4 T C 15: 78,492,346 (GRCm39) V125A probably damaging Het
Ddx43 G A 9: 78,308,218 (GRCm39) V131I probably benign Het
Elp4 A G 2: 105,734,788 (GRCm39) S16P possibly damaging Het
Espl1 T A 15: 102,223,995 (GRCm39) V1182E probably damaging Het
Fhod3 T C 18: 25,223,935 (GRCm39) S1094P possibly damaging Het
Fmo6 A T 1: 162,748,014 (GRCm39) V350D probably damaging Het
Frem1 A G 4: 82,858,773 (GRCm39) F1545S probably damaging Het
Gata3 T A 2: 9,863,245 (GRCm39) H423L possibly damaging Het
Golt1a A T 1: 133,248,032 (GRCm39) M87L probably damaging Het
Gpr171 A T 3: 59,005,544 (GRCm39) V77E probably damaging Het
Hectd2 A G 19: 36,596,186 (GRCm39) D757G probably benign Het
Hmmr A G 11: 40,606,694 (GRCm39) probably null Het
Il31ra A G 13: 112,660,441 (GRCm39) V635A possibly damaging Het
Lama1 T C 17: 68,053,905 (GRCm39) probably null Het
Ltbp4 G A 7: 27,010,140 (GRCm39) P1140L probably damaging Het
Macf1 A G 4: 123,386,988 (GRCm39) L1210P possibly damaging Het
Meox2 A T 12: 37,158,830 (GRCm39) M1L probably benign Het
Mex3d A G 10: 80,217,205 (GRCm39) S671P unknown Het
Mrgprb2 C T 7: 48,202,129 (GRCm39) V199I probably benign Het
Mroh9 A T 1: 162,902,271 (GRCm39) V114E probably damaging Het
Muc5b A G 7: 141,412,834 (GRCm39) K1927E unknown Het
Or4f52 A C 2: 111,061,497 (GRCm39) probably null Het
Or6c35 T A 10: 129,169,578 (GRCm39) I276K probably benign Het
Otogl C T 10: 107,617,911 (GRCm39) C1734Y probably damaging Het
Parp4 T A 14: 56,864,838 (GRCm39) probably null Het
Pcdh15 T A 10: 74,021,258 (GRCm39) N162K probably damaging Het
Pcdhb10 A C 18: 37,546,898 (GRCm39) H658P possibly damaging Het
Pgm2l1 G T 7: 99,904,747 (GRCm39) A160S possibly damaging Het
Prkag2 T A 5: 25,305,178 (GRCm39) probably benign Het
Rap1gap2 A G 11: 74,296,616 (GRCm39) L457P probably damaging Het
Rasef C T 4: 73,658,818 (GRCm39) V463M probably benign Het
Rb1 T C 14: 73,520,414 (GRCm39) S42G unknown Het
Reep3 C A 10: 66,875,356 (GRCm39) V36F probably damaging Het
Rhcg A G 7: 79,248,716 (GRCm39) probably null Het
Sbno1 T C 5: 124,533,994 (GRCm39) S661G probably benign Het
Slc25a3 T G 10: 90,958,190 (GRCm39) Q50P possibly damaging Het
Slc2a13 T A 15: 91,228,008 (GRCm39) I395F probably benign Het
Slc6a5 C T 7: 49,559,991 (GRCm39) probably benign Het
Snta1 G C 2: 154,219,987 (GRCm39) T391S possibly damaging Het
Spata7 T C 12: 98,629,479 (GRCm39) probably null Het
Stx17 A G 4: 48,158,809 (GRCm39) probably null Het
Terf2 A T 8: 107,803,486 (GRCm39) S365T probably benign Het
Tmem231 G A 8: 112,653,524 (GRCm39) probably benign Het
Trim8 A T 19: 46,491,346 (GRCm39) H155L probably benign Het
Wipi2 T A 5: 142,641,693 (GRCm39) V83D probably damaging Het
Zbtb47 T G 9: 121,592,725 (GRCm39) D348E probably benign Het
Zfp316 C A 5: 143,240,639 (GRCm39) R460L possibly damaging Het
Zfp799 C T 17: 33,039,259 (GRCm39) V336M probably damaging Het
Zfp947 A T 17: 22,365,395 (GRCm39) I93N probably damaging Het
Zranb3 A G 1: 127,968,694 (GRCm39) Y74H probably benign Het
Other mutations in Chd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Chd3 APN 11 69,247,888 (GRCm39) missense probably damaging 0.96
IGL00551:Chd3 APN 11 69,237,455 (GRCm39) missense probably damaging 1.00
IGL00661:Chd3 APN 11 69,248,209 (GRCm39) missense possibly damaging 0.84
IGL00698:Chd3 APN 11 69,240,697 (GRCm39) missense probably damaging 0.98
IGL01075:Chd3 APN 11 69,250,791 (GRCm39) missense probably damaging 1.00
IGL01309:Chd3 APN 11 69,248,557 (GRCm39) missense probably damaging 0.99
IGL01317:Chd3 APN 11 69,244,037 (GRCm39) missense probably damaging 1.00
IGL01374:Chd3 APN 11 69,250,806 (GRCm39) missense probably damaging 0.99
IGL01444:Chd3 APN 11 69,239,568 (GRCm39) missense probably benign 0.28
IGL01617:Chd3 APN 11 69,249,060 (GRCm39) unclassified probably benign
IGL01635:Chd3 APN 11 69,252,076 (GRCm39) splice site probably benign
IGL01942:Chd3 APN 11 69,240,931 (GRCm39) critical splice donor site probably null
IGL01962:Chd3 APN 11 69,248,319 (GRCm39) missense possibly damaging 0.46
IGL01981:Chd3 APN 11 69,251,501 (GRCm39) missense probably damaging 0.99
IGL02022:Chd3 APN 11 69,251,886 (GRCm39) missense probably damaging 1.00
IGL02098:Chd3 APN 11 69,250,655 (GRCm39) missense probably damaging 1.00
IGL02218:Chd3 APN 11 69,242,920 (GRCm39) unclassified probably benign
IGL02415:Chd3 APN 11 69,239,739 (GRCm39) splice site probably benign
IGL02648:Chd3 APN 11 69,242,976 (GRCm39) missense probably damaging 1.00
IGL02951:Chd3 APN 11 69,251,874 (GRCm39) critical splice donor site probably null
IGL03030:Chd3 APN 11 69,245,230 (GRCm39) missense possibly damaging 0.64
IGL03102:Chd3 APN 11 69,252,022 (GRCm39) nonsense probably null
IGL03168:Chd3 APN 11 69,239,741 (GRCm39) splice site probably benign
IGL03327:Chd3 APN 11 69,241,012 (GRCm39) missense probably damaging 1.00
burg UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
castello UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
feste UTSW 11 69,245,252 (GRCm39) nonsense probably null
Fortress UTSW 11 69,254,876 (GRCm39) nonsense probably null
moat UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
Redoubt UTSW 11 69,244,727 (GRCm39) unclassified probably benign
schloss UTSW 11 69,252,886 (GRCm39) nonsense probably null
siege UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0009:Chd3 UTSW 11 69,240,732 (GRCm39) missense probably damaging 0.99
R0056:Chd3 UTSW 11 69,250,739 (GRCm39) unclassified probably benign
R0129:Chd3 UTSW 11 69,239,327 (GRCm39) nonsense probably null
R0130:Chd3 UTSW 11 69,250,656 (GRCm39) missense probably damaging 1.00
R0309:Chd3 UTSW 11 69,247,844 (GRCm39) missense probably damaging 1.00
R0330:Chd3 UTSW 11 69,247,159 (GRCm39) missense probably damaging 1.00
R0449:Chd3 UTSW 11 69,248,367 (GRCm39) missense probably damaging 0.98
R0502:Chd3 UTSW 11 69,244,931 (GRCm39) missense probably damaging 0.98
R0540:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0571:Chd3 UTSW 11 69,252,495 (GRCm39) critical splice donor site probably null
R0607:Chd3 UTSW 11 69,235,184 (GRCm39) missense probably damaging 0.98
R0616:Chd3 UTSW 11 69,236,313 (GRCm39) missense probably damaging 0.96
R0630:Chd3 UTSW 11 69,238,021 (GRCm39) missense probably damaging 1.00
R1436:Chd3 UTSW 11 69,248,400 (GRCm39) splice site probably null
R1484:Chd3 UTSW 11 69,250,725 (GRCm39) missense probably benign 0.17
R1741:Chd3 UTSW 11 69,246,480 (GRCm39) missense probably damaging 1.00
R1748:Chd3 UTSW 11 69,255,523 (GRCm39) missense possibly damaging 0.81
R1751:Chd3 UTSW 11 69,244,727 (GRCm39) unclassified probably benign
R1833:Chd3 UTSW 11 69,244,949 (GRCm39) missense probably damaging 1.00
R2012:Chd3 UTSW 11 69,239,878 (GRCm39) missense probably benign 0.01
R2101:Chd3 UTSW 11 69,239,877 (GRCm39) missense probably benign
R2147:Chd3 UTSW 11 69,239,854 (GRCm39) missense probably benign 0.00
R2513:Chd3 UTSW 11 69,251,471 (GRCm39) missense probably damaging 1.00
R2877:Chd3 UTSW 11 69,251,998 (GRCm39) nonsense probably null
R2879:Chd3 UTSW 11 69,254,924 (GRCm39) missense possibly damaging 0.52
R2880:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2881:Chd3 UTSW 11 69,242,946 (GRCm39) missense probably damaging 1.00
R2973:Chd3 UTSW 11 69,251,442 (GRCm39) missense probably damaging 1.00
R3611:Chd3 UTSW 11 69,252,973 (GRCm39) missense possibly damaging 0.53
R3743:Chd3 UTSW 11 69,254,876 (GRCm39) nonsense probably null
R3845:Chd3 UTSW 11 69,237,585 (GRCm39) missense possibly damaging 0.65
R3889:Chd3 UTSW 11 69,250,011 (GRCm39) missense probably damaging 0.98
R4007:Chd3 UTSW 11 69,239,827 (GRCm39) missense probably benign
R4115:Chd3 UTSW 11 69,248,343 (GRCm39) missense possibly damaging 0.95
R4515:Chd3 UTSW 11 69,240,703 (GRCm39) missense probably benign 0.00
R4612:Chd3 UTSW 11 69,244,035 (GRCm39) nonsense probably null
R4622:Chd3 UTSW 11 69,239,834 (GRCm39) missense probably damaging 0.98
R4634:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4635:Chd3 UTSW 11 69,253,013 (GRCm39) unclassified probably benign
R4859:Chd3 UTSW 11 69,250,722 (GRCm39) missense possibly damaging 0.79
R4930:Chd3 UTSW 11 69,245,034 (GRCm39) unclassified probably benign
R5173:Chd3 UTSW 11 69,260,069 (GRCm39) unclassified probably benign
R5287:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5403:Chd3 UTSW 11 69,239,895 (GRCm39) splice site probably null
R5511:Chd3 UTSW 11 69,252,301 (GRCm39) missense probably damaging 1.00
R5666:Chd3 UTSW 11 69,244,177 (GRCm39) missense possibly damaging 0.83
R5702:Chd3 UTSW 11 69,252,261 (GRCm39) missense possibly damaging 0.46
R6045:Chd3 UTSW 11 69,242,944 (GRCm39) missense possibly damaging 0.90
R6063:Chd3 UTSW 11 69,240,063 (GRCm39) missense probably benign
R6211:Chd3 UTSW 11 69,243,503 (GRCm39) missense probably damaging 1.00
R6215:Chd3 UTSW 11 69,247,380 (GRCm39) missense probably damaging 1.00
R6217:Chd3 UTSW 11 69,236,361 (GRCm39) missense probably damaging 1.00
R6302:Chd3 UTSW 11 69,244,604 (GRCm39) missense probably damaging 0.98
R6329:Chd3 UTSW 11 69,252,510 (GRCm39) missense possibly damaging 0.70
R6349:Chd3 UTSW 11 69,254,857 (GRCm39) missense possibly damaging 0.50
R6453:Chd3 UTSW 11 69,240,938 (GRCm39) nonsense probably null
R6548:Chd3 UTSW 11 69,252,886 (GRCm39) nonsense probably null
R6582:Chd3 UTSW 11 69,259,982 (GRCm39) unclassified probably benign
R6721:Chd3 UTSW 11 69,260,045 (GRCm39) unclassified probably benign
R6776:Chd3 UTSW 11 69,245,296 (GRCm39) missense probably damaging 1.00
R6900:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
R7085:Chd3 UTSW 11 69,260,027 (GRCm39) missense unknown
R7136:Chd3 UTSW 11 69,239,264 (GRCm39) missense probably null 0.37
R7164:Chd3 UTSW 11 69,253,132 (GRCm39) missense probably damaging 1.00
R7200:Chd3 UTSW 11 69,254,921 (GRCm39) missense possibly damaging 0.94
R7226:Chd3 UTSW 11 69,260,037 (GRCm39) missense unknown
R7238:Chd3 UTSW 11 69,254,873 (GRCm39) missense probably benign 0.31
R7316:Chd3 UTSW 11 69,236,394 (GRCm39) missense probably damaging 0.99
R7560:Chd3 UTSW 11 69,247,096 (GRCm39) missense probably damaging 1.00
R7684:Chd3 UTSW 11 69,248,692 (GRCm39) missense possibly damaging 0.83
R7748:Chd3 UTSW 11 69,246,459 (GRCm39) missense probably benign 0.00
R7820:Chd3 UTSW 11 69,244,064 (GRCm39) missense probably damaging 1.00
R7885:Chd3 UTSW 11 69,247,451 (GRCm39) missense probably benign 0.13
R8150:Chd3 UTSW 11 69,254,510 (GRCm39) missense probably benign 0.02
R8161:Chd3 UTSW 11 69,241,711 (GRCm39) missense probably damaging 1.00
R8271:Chd3 UTSW 11 69,251,483 (GRCm39) missense probably damaging 1.00
R8334:Chd3 UTSW 11 69,241,622 (GRCm39) missense probably damaging 1.00
R8423:Chd3 UTSW 11 69,245,252 (GRCm39) nonsense probably null
R8690:Chd3 UTSW 11 69,246,648 (GRCm39) critical splice acceptor site probably benign
R8828:Chd3 UTSW 11 69,247,097 (GRCm39) missense probably damaging 1.00
R8857:Chd3 UTSW 11 69,253,146 (GRCm39) missense probably benign 0.22
R9124:Chd3 UTSW 11 69,260,162 (GRCm39) missense unknown
R9170:Chd3 UTSW 11 69,241,648 (GRCm39) missense possibly damaging 0.64
R9213:Chd3 UTSW 11 69,255,628 (GRCm39) missense possibly damaging 0.53
R9285:Chd3 UTSW 11 69,249,954 (GRCm39) missense possibly damaging 0.64
R9293:Chd3 UTSW 11 69,244,027 (GRCm39) missense possibly damaging 0.94
R9368:Chd3 UTSW 11 69,251,200 (GRCm39) missense probably damaging 1.00
R9521:Chd3 UTSW 11 69,249,133 (GRCm39) missense probably benign 0.01
R9544:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
R9554:Chd3 UTSW 11 69,251,015 (GRCm39) missense probably damaging 1.00
R9588:Chd3 UTSW 11 69,241,046 (GRCm39) missense probably damaging 1.00
X0022:Chd3 UTSW 11 69,247,084 (GRCm39) missense probably damaging 1.00
X0062:Chd3 UTSW 11 69,245,271 (GRCm39) missense possibly damaging 0.64
Z1186:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1186:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1187:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1187:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1188:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1188:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1189:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1189:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1190:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1190:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1191:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1191:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Z1192:Chd3 UTSW 11 69,252,277 (GRCm39) missense probably benign
Z1192:Chd3 UTSW 11 69,239,271 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCACTGTGACTCCTGCCATAG -3'
(R):5'- CTCTCAGATTGAGGAGATCGAGC -3'

Sequencing Primer
(F):5'- TACTCTAAACAGTGAGCCCTGAGTG -3'
(R):5'- TTGAGGAGATCGAGCGAGAGATC -3'
Posted On 2018-05-04