Incidental Mutation 'R6414:Il31ra'
ID514882
Institutional Source Beutler Lab
Gene Symbol Il31ra
Ensembl Gene ENSMUSG00000050377
Gene Nameinterleukin 31 receptor A
SynonymsGLM-R, GPL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location112519898-112594360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112523907 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 635 (V635A)
Ref Sequence ENSEMBL: ENSMUSP00000153382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051756
AA Change: V716A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: V716A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FN3 115 198 7.75e0 SMART
Blast:FN3 216 297 1e-40 BLAST
FN3 325 394 1.15e1 SMART
FN3 408 490 7.18e-3 SMART
low complexity region 508 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223577
Predicted Effect probably benign
Transcript: ENSMUST00000223752
Predicted Effect probably benign
Transcript: ENSMUST00000223819
Predicted Effect possibly damaging
Transcript: ENSMUST00000224510
AA Change: V635A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000224576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fhod3 T C 18: 25,090,878 S1094P possibly damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Il31ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Il31ra APN 13 112547478 missense possibly damaging 0.94
IGL00639:Il31ra APN 13 112549559 nonsense probably null
IGL01640:Il31ra APN 13 112531758 missense possibly damaging 0.58
IGL02009:Il31ra APN 13 112533867 missense probably damaging 0.98
IGL02431:Il31ra APN 13 112530296 missense probably damaging 1.00
IGL02675:Il31ra APN 13 112524352 missense probably benign 0.00
IGL02718:Il31ra APN 13 112530369 nonsense probably null
IGL03388:Il31ra APN 13 112546212 missense probably damaging 1.00
IGL03408:Il31ra APN 13 112525888 missense probably benign 0.21
R0482:Il31ra UTSW 13 112527481 missense possibly damaging 0.89
R0639:Il31ra UTSW 13 112525843 missense possibly damaging 0.95
R0905:Il31ra UTSW 13 112531673 missense probably damaging 1.00
R0948:Il31ra UTSW 13 112530378 missense possibly damaging 0.81
R1420:Il31ra UTSW 13 112531752 missense probably damaging 1.00
R1538:Il31ra UTSW 13 112547466 missense possibly damaging 0.91
R1776:Il31ra UTSW 13 112541239 missense probably damaging 0.97
R1931:Il31ra UTSW 13 112541222 missense probably damaging 1.00
R2006:Il31ra UTSW 13 112530356 missense probably damaging 1.00
R2134:Il31ra UTSW 13 112543888 missense possibly damaging 0.94
R3103:Il31ra UTSW 13 112530351 missense probably damaging 1.00
R4089:Il31ra UTSW 13 112551919 nonsense probably null
R4742:Il31ra UTSW 13 112523967 nonsense probably null
R4787:Il31ra UTSW 13 112527545 missense possibly damaging 0.82
R5154:Il31ra UTSW 13 112523997 missense possibly damaging 0.87
R5193:Il31ra UTSW 13 112524330 missense probably benign 0.34
R5402:Il31ra UTSW 13 112524135 missense probably benign 0.01
R5743:Il31ra UTSW 13 112527487 missense possibly damaging 0.89
R5917:Il31ra UTSW 13 112546312 missense probably benign
R6126:Il31ra UTSW 13 112530374 missense probably damaging 1.00
R6580:Il31ra UTSW 13 112551942 missense possibly damaging 0.90
R6727:Il31ra UTSW 13 112547368 missense probably damaging 1.00
R6783:Il31ra UTSW 13 112551988 critical splice acceptor site probably null
R6912:Il31ra UTSW 13 112549464 missense probably damaging 0.99
R6925:Il31ra UTSW 13 112527529 missense possibly damaging 0.56
R7187:Il31ra UTSW 13 112546311 missense probably benign 0.04
R7210:Il31ra UTSW 13 112549500 missense possibly damaging 0.95
R7236:Il31ra UTSW 13 112523905 makesense probably null
R7323:Il31ra UTSW 13 112551963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCCATTCTTCCTGGC -3'
(R):5'- GAGCCCTCCGTTTTAACTGAG -3'

Sequencing Primer
(F):5'- GGCCTAAGTCCACATCTGTG -3'
(R):5'- AACTGAGGTTGCTTCTGAAGACTCC -3'
Posted On2018-05-04