Incidental Mutation 'R6414:Fhod3'
ID514891
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6414 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25090878 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1094 (S1094P)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037097
AA Change: S1094P

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: S1094P

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 A G 11: 69,884,336 V367A probably benign Het
Alpk1 T C 3: 127,680,209 D715G probably benign Het
Atg101 T A 15: 101,290,460 C149S probably benign Het
Atp2c1 A T 9: 105,466,656 I84N probably damaging Het
Ceacam20 C A 7: 19,976,131 A360E probably damaging Het
Chd3 A T 11: 69,352,545 probably null Het
Clcc1 G A 3: 108,676,851 C517Y possibly damaging Het
Col6a5 T C 9: 105,892,266 probably null Het
Ctnna3 T C 10: 64,260,865 V394A probably benign Het
Ctsll3 A G 13: 60,800,299 F188S probably damaging Het
Cyth4 T C 15: 78,608,146 V125A probably damaging Het
Ddx43 G A 9: 78,400,936 V131I probably benign Het
Elp4 A G 2: 105,904,443 S16P possibly damaging Het
Espl1 T A 15: 102,315,560 V1182E probably damaging Het
Fmo6 A T 1: 162,920,445 V350D probably damaging Het
Frem1 A G 4: 82,940,536 F1545S probably damaging Het
Gata3 T A 2: 9,858,434 H423L possibly damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Golt1a A T 1: 133,320,294 M87L probably damaging Het
Gpr171 A T 3: 59,098,123 V77E probably damaging Het
Hectd2 A G 19: 36,618,786 D757G probably benign Het
Hmmr A G 11: 40,715,867 probably null Het
Il31ra A G 13: 112,523,907 V635A possibly damaging Het
Lama1 T C 17: 67,746,910 probably null Het
Ltbp4 G A 7: 27,310,715 P1140L probably damaging Het
Macf1 A G 4: 123,493,195 L1210P possibly damaging Het
Meox2 A T 12: 37,108,831 M1L probably benign Het
Mex3d A G 10: 80,381,371 S671P unknown Het
Mrgprb2 C T 7: 48,552,381 V199I probably benign Het
Mroh9 A T 1: 163,074,702 V114E probably damaging Het
Muc5b A G 7: 141,859,097 K1927E unknown Het
Olfr1275 A C 2: 111,231,152 probably null Het
Olfr781 T A 10: 129,333,709 I276K probably benign Het
Otogl C T 10: 107,782,050 C1734Y probably damaging Het
Parp4 T A 14: 56,627,381 probably null Het
Pcdh15 T A 10: 74,185,426 N162K probably damaging Het
Pcdhb10 A C 18: 37,413,845 H658P possibly damaging Het
Pgm2l1 G T 7: 100,255,540 A160S possibly damaging Het
Prkag2 T A 5: 25,100,180 probably benign Het
Rap1gap2 A G 11: 74,405,790 L457P probably damaging Het
Rasef C T 4: 73,740,581 V463M probably benign Het
Rb1 T C 14: 73,282,974 S42G unknown Het
Reep3 C A 10: 67,039,577 V36F probably damaging Het
Rhcg A G 7: 79,598,968 probably null Het
Sbno1 T C 5: 124,395,931 S661G probably benign Het
Slc25a3 T G 10: 91,122,328 Q50P possibly damaging Het
Slc2a13 T A 15: 91,343,805 I395F probably benign Het
Slc6a5 C T 7: 49,910,243 probably benign Het
Snta1 G C 2: 154,378,067 T391S possibly damaging Het
Spata7 T C 12: 98,663,220 probably null Het
Stx17 A G 4: 48,158,809 probably null Het
Terf2 A T 8: 107,076,854 S365T probably benign Het
Tmem231 G A 8: 111,926,892 probably benign Het
Trim8 A T 19: 46,502,907 H155L probably benign Het
Wipi2 T A 5: 142,655,938 V83D probably damaging Het
Zfp316 C A 5: 143,254,884 R460L possibly damaging Het
Zfp651 T G 9: 121,763,659 D348E probably benign Het
Zfp799 C T 17: 32,820,285 V336M probably damaging Het
Zfp947 A T 17: 22,146,414 I93N probably damaging Het
Zranb3 A G 1: 128,040,957 Y74H probably benign Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0570:Fhod3 UTSW 18 25112583 missense probably benign 0.27
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAACACTCCTCAGGGCTTAG -3'
(R):5'- AGACTACACGGCCATCCATG -3'

Sequencing Primer
(F):5'- CTCCTCAGGGCTTAGGGTGG -3'
(R):5'- TTTGCTTCTTTTCCTGGGTTGTC -3'
Posted On2018-05-04