Incidental Mutation 'R6375:Ccser1'
ID514910
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6375 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 61311168 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 105 (L105*)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
Predicted Effect probably null
Transcript: ENSMUST00000045522
AA Change: L105*
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: L105*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126214
AA Change: L105*
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: L105*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,562 I797N possibly damaging Het
Actbl2 A G 13: 111,255,944 E271G probably damaging Het
Aplp2 T C 9: 31,157,788 N526D probably benign Het
Cacna1e A C 1: 154,479,305 N389K probably damaging Het
Ccdc18 T C 5: 108,174,954 I640T possibly damaging Het
Ccdc39 T A 3: 33,814,367 T857S probably benign Het
Efhc1 T A 1: 20,972,940 M361K probably benign Het
Eml5 T C 12: 98,798,868 Het
Fgfr2 C A 7: 130,167,745 L637F probably damaging Het
Fmo9 A G 1: 166,664,595 probably null Het
Gm4302 A G 10: 100,341,396 T181A probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hoxb4 A G 11: 96,320,327 *251W probably null Het
Il1r1 T A 1: 40,294,890 Y207N probably damaging Het
Kcnc2 C T 10: 112,463,189 T622M possibly damaging Het
Kcnk9 C T 15: 72,546,243 A13T probably benign Het
Kdm4c C T 4: 74,330,715 P69S probably damaging Het
Kmt2e T C 5: 23,499,519 S1237P probably benign Het
Lrrc37a G A 11: 103,501,089 T1170I probably benign Het
Lyn T A 4: 3,745,527 F109I probably damaging Het
Lynx1 T C 15: 74,751,319 Y88C probably damaging Het
Mon1b T A 8: 113,638,077 I162N probably damaging Het
Muc4 A G 16: 32,736,243 probably benign Het
Nbn T A 4: 15,979,327 F437L probably benign Het
Neil3 T C 8: 53,587,276 K564E possibly damaging Het
Nfe2l1 A T 11: 96,820,051 S293T probably damaging Het
Olfr121 T A 17: 37,752,099 S82T probably benign Het
Olfr292 C T 7: 86,695,059 A201V probably benign Het
Olfr577 T C 7: 102,973,753 T80A probably damaging Het
Olfr706 C A 7: 106,886,014 A268S probably benign Het
Pcdhb22 A T 18: 37,518,304 probably benign Het
Pcdhgb6 A G 18: 37,742,625 N129D probably damaging Het
Pias2 C T 18: 77,152,670 T574M possibly damaging Het
Plec G A 15: 76,177,640 T2564I probably damaging Het
Qrich2 A G 11: 116,458,228 probably benign Het
Scgb1b12 T A 7: 32,334,459 V48E probably damaging Het
Scn5a A T 9: 119,543,356 L224Q probably damaging Het
Snx3 T A 10: 42,534,731 Y132* probably null Het
Stk39 T A 2: 68,392,238 I161F probably benign Het
Tcaf2 A C 6: 42,626,178 L816R probably damaging Het
Thap4 C A 1: 93,725,156 probably null Het
Tmc5 T A 7: 118,656,814 V704E probably damaging Het
Tmem39a A G 16: 38,585,237 T59A probably benign Het
Tshz2 A G 2: 169,886,019 N376S probably damaging Het
Vmn1r60 T C 7: 5,545,018 N28D probably damaging Het
Zfp637 C T 6: 117,845,324 R138W probably damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCCAGCACTAACTCGAGCTC -3'
(R):5'- AGCAGCTTCTTGGTGGACTG -3'

Sequencing Primer
(F):5'- CACTAACTCGAGCTCAGGGAG -3'
(R):5'- TGTGAATCCAGAATCGTCCC -3'
Posted On2018-05-04