Incidental Mutation 'R6376:Podxl'
ID514971
Institutional Source Beutler Lab
Gene Symbol Podxl
Ensembl Gene ENSMUSG00000025608
Gene Namepodocalyxin-like
SynonymsPC, Ly102, podocalyxin, Pclp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location31519488-31563981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31528497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 204 (T204S)
Ref Sequence ENSEMBL: ENSMUSP00000026698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026698]
Predicted Effect probably benign
Transcript: ENSMUST00000026698
AA Change: T204S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026698
Gene: ENSMUSG00000025608
AA Change: T204S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 61 91 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 196 208 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Pfam:CD34_antigen 301 503 6e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136877
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe kidney defects including absence of the podocyte slit diaphragm and foot processes and anuria. While a subset display edema and/or omphalocele, most mice appear normal at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Vipr1 C A 9: 121,664,574 N230K probably damaging Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Podxl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Podxl APN 6 31528704 missense possibly damaging 0.53
IGL01576:Podxl APN 6 31524384 missense probably damaging 1.00
IGL02151:Podxl APN 6 31524459 missense possibly damaging 0.65
IGL02240:Podxl APN 6 31524998 missense probably damaging 1.00
IGL02487:Podxl APN 6 31523022 makesense probably null
IGL02598:Podxl APN 6 31524420 missense probably damaging 1.00
IGL02957:Podxl APN 6 31528449 splice site probably benign
R2042:Podxl UTSW 6 31523116 missense possibly damaging 0.75
R3840:Podxl UTSW 6 31523081 missense probably damaging 1.00
R4675:Podxl UTSW 6 31526644 missense possibly damaging 0.95
R5509:Podxl UTSW 6 31526613 missense probably benign 0.00
R5754:Podxl UTSW 6 31524394 missense probably damaging 1.00
R5876:Podxl UTSW 6 31528456 critical splice donor site probably null
R6242:Podxl UTSW 6 31526245 missense probably benign 0.30
R6493:Podxl UTSW 6 31525046 missense probably damaging 1.00
R7113:Podxl UTSW 6 31524733 critical splice acceptor site probably null
R7299:Podxl UTSW 6 31524436 missense probably damaging 1.00
R7301:Podxl UTSW 6 31524436 missense probably damaging 1.00
R7338:Podxl UTSW 6 31529006 missense unknown
R7358:Podxl UTSW 6 31524994 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGAGAAAATGCACTGCCAAGTC -3'
(R):5'- GGGGCTAATCAACGTCTCTTC -3'

Sequencing Primer
(F):5'- TCTACGGACCAAATGTGTGC -3'
(R):5'- GGCTAATCAACGTCTCTTCTCAGC -3'
Posted On2018-05-04