Incidental Mutation 'R6376:Vipr1'
ID514985
Institutional Source Beutler Lab
Gene Symbol Vipr1
Ensembl Gene ENSMUSG00000032528
Gene Namevasoactive intestinal peptide receptor 1
SynonymsVPAC1, VIP-R1, VIP receptor subtype 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6376 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121642716-121672954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121664574 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 230 (N230K)
Ref Sequence ENSEMBL: ENSMUSP00000035115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035115]
Predicted Effect probably damaging
Transcript: ENSMUST00000035115
AA Change: N230K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035115
Gene: ENSMUSG00000032528
AA Change: N230K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
HormR 59 131 7.38e-26 SMART
Pfam:7tm_2 140 386 1.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149959
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality associated with severe neonatal growth failure, enlarged cecum, intestinal hemorrhage, and enterocyte hyperproliferation in addition to disorganized islets and impaired glucose homeostasisin surviving mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,428,156 E106D probably damaging Het
4933425L06Rik T C 13: 105,119,965 I514T possibly damaging Het
A830018L16Rik A T 1: 11,798,494 N333Y probably damaging Het
Abca4 T A 3: 122,123,660 M1007K possibly damaging Het
Accsl T A 2: 93,856,998 I495F probably damaging Het
Acsl3 T C 1: 78,696,465 S373P possibly damaging Het
Adam7 A G 14: 68,505,097 I689T possibly damaging Het
Akap11 G A 14: 78,514,896 T179I probably damaging Het
Ankmy1 T C 1: 92,888,465 K309R possibly damaging Het
Apaf1 A T 10: 91,023,811 I824N probably damaging Het
Apc2 T A 10: 80,312,654 C1152S probably damaging Het
Arhgap17 C A 7: 123,300,504 W409L probably damaging Het
Arhgef15 T C 11: 68,954,970 I19V unknown Het
Arnt C A 3: 95,490,625 P573H probably damaging Het
Arvcf G A 16: 18,405,132 G932R probably damaging Het
Atg4a-ps C T 3: 103,645,728 W99* probably null Het
Atp13a5 T A 16: 29,237,252 D1052V probably benign Het
Atp2b4 T C 1: 133,715,059 T1103A probably damaging Het
B4galnt4 C A 7: 141,067,422 Q362K possibly damaging Het
Cd163l1 G A 7: 140,228,729 G851D probably damaging Het
Cd320 T A 17: 33,847,517 N90K probably benign Het
Cep170b A T 12: 112,732,068 I87F probably damaging Het
Coq3 T G 4: 21,900,486 C238G probably benign Het
Cpa5 A T 6: 30,614,045 Q62L probably benign Het
Ctsg A T 14: 56,101,653 C49* probably null Het
Cul9 T C 17: 46,508,563 T2000A probably damaging Het
Dedd C T 1: 171,340,222 P155S probably benign Het
Dnah1 A G 14: 31,275,608 S2598P probably damaging Het
Dnah14 C T 1: 181,605,894 P379S possibly damaging Het
Dync2h1 A T 9: 7,165,703 S519R probably benign Het
Eea1 A G 10: 96,038,798 S1192G probably benign Het
Eif5b T C 1: 38,045,679 I869T probably damaging Het
Elavl4 C A 4: 110,255,454 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Exoc3l2 G A 7: 19,469,710 A76T possibly damaging Het
Fam89b T C 19: 5,728,729 Y144C probably damaging Het
Greb1 T C 12: 16,699,579 E1082G probably damaging Het
Gtf3a A T 5: 146,953,988 probably null Het
Hoxc12 C A 15: 102,937,089 F79L possibly damaging Het
Hspb8 G T 5: 116,409,432 L164I probably damaging Het
Ina C T 19: 47,015,125 A124V probably benign Het
Inhbb T A 1: 119,417,681 I293F probably damaging Het
Itpr3 A G 17: 27,095,475 Y633C possibly damaging Het
Jag2 C T 12: 112,909,329 V1102I probably benign Het
Kalrn A T 16: 33,975,991 F1138Y probably benign Het
Large2 T A 2: 92,370,508 probably benign Het
Lats2 A G 14: 57,722,509 S177P probably benign Het
Lims2 G A 18: 31,954,462 R124H possibly damaging Het
Lrp2 T A 2: 69,483,443 T2315S probably benign Het
Lrrc4c A C 2: 97,629,046 T6P probably benign Het
Lrrk2 T C 15: 91,742,266 L1171S possibly damaging Het
Man2b2 A T 5: 36,821,034 M302K probably damaging Het
Mocos G A 18: 24,701,485 G860R possibly damaging Het
Mylk3 T A 8: 85,358,942 D258V possibly damaging Het
Nkx1-2 C T 7: 132,599,511 D6N probably damaging Het
Nrp2 A G 1: 62,719,017 N54S possibly damaging Het
Olfr715 A G 7: 107,128,641 F251L probably benign Het
Pacsin1 A T 17: 27,707,905 T195S probably benign Het
Pank4 T C 4: 154,972,236 probably null Het
Pdgfra A T 5: 75,166,519 M126L probably benign Het
Podxl T A 6: 31,528,497 T204S probably benign Het
Pole G A 5: 110,336,374 D2175N probably damaging Het
Pramef25 C T 4: 143,950,697 G104E probably benign Het
Prkdc A G 16: 15,769,885 K2545E probably benign Het
Prodh T C 16: 18,079,985 I183V probably benign Het
Ptch1 T C 13: 63,543,608 D277G possibly damaging Het
Rapgef5 G A 12: 117,721,253 V246M probably damaging Het
Rubcnl A G 14: 75,032,394 N164S probably benign Het
Samd4 A T 14: 47,052,962 L175F probably damaging Het
Scimp C A 11: 70,798,067 W41L possibly damaging Het
Scn3a T A 2: 65,461,499 K1634N possibly damaging Het
Spta1 A G 1: 174,203,322 R957G probably benign Het
Sptlc3 T A 2: 139,636,772 N550K probably benign Het
Srebf1 T C 11: 60,203,535 N609D probably null Het
Styxl1 A T 5: 135,747,810 L164H probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tnfsf15 T C 4: 63,745,030 M19V probably damaging Het
Trappc8 G C 18: 20,837,075 R953G probably benign Het
Trav13-1 A G 14: 53,545,343 N50S probably benign Het
Trim12a T C 7: 104,306,034 K161E probably benign Het
Xirp1 A T 9: 120,018,491 V3E probably damaging Het
Zfp768 A G 7: 127,344,720 F82L probably benign Het
Other mutations in Vipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Vipr1 APN 9 121665178 missense probably damaging 0.99
IGL01779:Vipr1 APN 9 121664630 missense probably damaging 1.00
IGL01809:Vipr1 APN 9 121661440 missense possibly damaging 0.70
IGL02250:Vipr1 APN 9 121665189 missense probably benign 0.10
IGL02677:Vipr1 APN 9 121660283 splice site probably benign
bernalillo UTSW 9 121664618 missense probably damaging 1.00
R0036:Vipr1 UTSW 9 121660983 missense probably benign
R0514:Vipr1 UTSW 9 121658049 missense probably damaging 1.00
R0629:Vipr1 UTSW 9 121660171 nonsense probably null
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1470:Vipr1 UTSW 9 121665520 missense possibly damaging 0.66
R1766:Vipr1 UTSW 9 121661419 missense possibly damaging 0.87
R1884:Vipr1 UTSW 9 121665864 missense possibly damaging 0.56
R1945:Vipr1 UTSW 9 121668474 missense probably damaging 1.00
R1945:Vipr1 UTSW 9 121668475 missense probably damaging 1.00
R2366:Vipr1 UTSW 9 121665184 missense probably benign 0.19
R4275:Vipr1 UTSW 9 121664618 missense probably damaging 1.00
R4600:Vipr1 UTSW 9 121665136 splice site probably null
R5012:Vipr1 UTSW 9 121658045 critical splice acceptor site probably null
R6190:Vipr1 UTSW 9 121664653 missense probably damaging 1.00
R6473:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
R6476:Vipr1 UTSW 9 121669423 missense probably benign 0.28
R6641:Vipr1 UTSW 9 121669565 makesense probably null
R6752:Vipr1 UTSW 9 121653893 missense probably damaging 0.99
R7189:Vipr1 UTSW 9 121664554 missense probably damaging 0.97
R7371:Vipr1 UTSW 9 121668555 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCACTGCACAGGTTTG -3'
(R):5'- CATTCATGAATGTCGGTGGAG -3'

Sequencing Primer
(F):5'- CTGCACAGGTTTGAAAAGCCTG -3'
(R):5'- ACCTCATAAGTAGGCTAGGGTTGTAC -3'
Posted On2018-05-04