Incidental Mutation 'R6377:Cyp4a14'
ID515034
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6377 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115486200-115496142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115496083 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 11 (Y11H)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: Y11H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: Y11H

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115489952 splice site probably benign
IGL01539:Cyp4a14 APN 4 115487177 missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115494937 nonsense probably null
IGL02309:Cyp4a14 APN 4 115491632 missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115495027 splice site probably benign
IGL03302:Cyp4a14 APN 4 115491378 missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115489996 missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115492170 missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115491134 missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115495936 missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115495929 missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115493609 missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115491410 missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115496100 nonsense probably null
R6269:Cyp4a14 UTSW 4 115491131 missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115487244 missense probably damaging 1.00
R6534:Cyp4a14 UTSW 4 115489959 splice site probably null
R6563:Cyp4a14 UTSW 4 115492086 missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115491194 missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115491081 missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115491161 missense probably damaging 1.00
R7544:Cyp4a14 UTSW 4 115491086 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCAGACTGCCCTGTATACTAATAC -3'
(R):5'- TTACCAAAGCTGATGTTGCAG -3'

Sequencing Primer
(F):5'- ACTAAACTCTCATAGCTTCATTCAGC -3'
(R):5'- AAAGCTGATGTTGCAGATTAATAAAC -3'
Posted On2018-05-04