Incidental Mutation 'R6377:Mtbp'
ID515073
Institutional Source Beutler Lab
Gene Symbol Mtbp
Ensembl Gene ENSMUSG00000022369
Gene NameMdm2, transformed 3T3 cell double minute p53 binding protein
SynonymsMDM2BP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6377 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55557408-55626423 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 55557620 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000129396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022998] [ENSMUST00000164542] [ENSMUST00000170046] [ENSMUST00000172387]
Predicted Effect probably null
Transcript: ENSMUST00000022998
AA Change: M1V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022998
Gene: ENSMUSG00000022369
AA Change: M1V

DomainStartEndE-ValueType
Pfam:MTBP_N 1 270 1.2e-116 PFAM
Pfam:MTBP_mid 287 626 1.4e-161 PFAM
Pfam:MTBP_C 630 884 1.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107207
Predicted Effect probably benign
Transcript: ENSMUST00000164542
SMART Domains Protein: ENSMUSP00000127456
Gene: ENSMUSG00000022370

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 18 55 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169517
Predicted Effect probably null
Transcript: ENSMUST00000170046
AA Change: M1V

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129396
Gene: ENSMUSG00000022369
AA Change: M1V

DomainStartEndE-ValueType
Pfam:MTBP_N 1 276 3.4e-145 PFAM
Pfam:MTBP_mid 286 626 3.1e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170135
Predicted Effect probably benign
Transcript: ENSMUST00000172387
SMART Domains Protein: ENSMUSP00000130722
Gene: ENSMUSG00000022370

DomainStartEndE-ValueType
Pfam:Ribosomal_L13 17 141 2.8e-47 PFAM
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncoprotein mouse double minute 2. The encoded protein regulates progression through the cell cycle and may be involved in tumor formation. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a reporter allele exhibit early embryonic lethality; interestingly, heterozygous mice are not tumor prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Kif5b A T 18: 6,212,562 L754Q probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Mtbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Mtbp APN 15 55617508 nonsense probably null
IGL00988:Mtbp APN 15 55558498 unclassified probably benign
IGL01608:Mtbp APN 15 55557689 nonsense probably null
IGL02422:Mtbp APN 15 55563043 missense possibly damaging 0.59
IGL02664:Mtbp APN 15 55619643 missense probably benign 0.01
IGL03160:Mtbp APN 15 55620617 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0008:Mtbp UTSW 15 55586493 splice site probably benign
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0242:Mtbp UTSW 15 55577486 missense possibly damaging 0.60
R0280:Mtbp UTSW 15 55586461 missense probably benign 0.04
R0302:Mtbp UTSW 15 55625424 missense probably damaging 0.99
R0387:Mtbp UTSW 15 55611029 missense possibly damaging 0.82
R0402:Mtbp UTSW 15 55569070 nonsense probably null
R0648:Mtbp UTSW 15 55603201 missense probably benign
R0735:Mtbp UTSW 15 55562942 nonsense probably null
R0845:Mtbp UTSW 15 55563090 critical splice donor site probably null
R1186:Mtbp UTSW 15 55564671 missense probably null 1.00
R1398:Mtbp UTSW 15 55577537 nonsense probably null
R1500:Mtbp UTSW 15 55617555 missense probably damaging 0.99
R1712:Mtbp UTSW 15 55571294 critical splice acceptor site probably null
R1893:Mtbp UTSW 15 55557668 missense probably benign 0.37
R1902:Mtbp UTSW 15 55606715 missense probably damaging 0.99
R1917:Mtbp UTSW 15 55564677 splice site probably benign
R2267:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2268:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2269:Mtbp UTSW 15 55569160 critical splice donor site probably null
R2383:Mtbp UTSW 15 55566194 missense probably damaging 1.00
R2512:Mtbp UTSW 15 55577536 missense probably damaging 0.98
R2924:Mtbp UTSW 15 55619814 missense probably benign 0.21
R2925:Mtbp UTSW 15 55619814 missense probably benign 0.21
R4164:Mtbp UTSW 15 55609521 missense probably benign
R4232:Mtbp UTSW 15 55620677 nonsense probably null
R4255:Mtbp UTSW 15 55620685 missense possibly damaging 0.66
R4438:Mtbp UTSW 15 55603215 missense probably benign 0.41
R5009:Mtbp UTSW 15 55603187 missense probably benign
R5132:Mtbp UTSW 15 55558569 missense possibly damaging 0.92
R5685:Mtbp UTSW 15 55562772 missense probably damaging 1.00
R5933:Mtbp UTSW 15 55571327 missense possibly damaging 0.92
R6554:Mtbp UTSW 15 55567249 missense probably damaging 0.99
R6811:Mtbp UTSW 15 55606546 intron probably null
R6942:Mtbp UTSW 15 55567200 missense probably damaging 0.99
R7134:Mtbp UTSW 15 55558565 missense probably benign 0.00
R7374:Mtbp UTSW 15 55562959 missense possibly damaging 0.95
R7397:Mtbp UTSW 15 55569151 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGCATGAAGGTTCCTACTGCC -3'
(R):5'- GAAACTCAAATCCTTCGCTTCC -3'

Sequencing Primer
(F):5'- AAGGTTCCTACTGCCGTCGC -3'
(R):5'- AATCCTTCGCTTCCCCGCC -3'
Posted On2018-05-04