Incidental Mutation 'R6377:Kif5b'
ID515085
Institutional Source Beutler Lab
Gene Symbol Kif5b
Ensembl Gene ENSMUSG00000006740
Gene Namekinesin family member 5B
Synonymskinesin heavy chain, Khc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6377 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location6201002-6242174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6212562 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 754 (L754Q)
Ref Sequence ENSEMBL: ENSMUSP00000025083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025083] [ENSMUST00000163210]
Predicted Effect probably damaging
Transcript: ENSMUST00000025083
AA Change: L754Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025083
Gene: ENSMUSG00000006740
AA Change: L754Q

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
coiled coil region 596 802 N/A INTRINSIC
coiled coil region 825 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163210
SMART Domains Protein: ENSMUSP00000130750
Gene: ENSMUSG00000006740

DomainStartEndE-ValueType
KISc 6 333 4.48e-172 SMART
low complexity region 341 352 N/A INTRINSIC
coiled coil region 412 564 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168187
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 94% (59/63)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos during organogenesis, exhibit growth retardation and fail to turn during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankib1 A G 5: 3,693,855 S812P possibly damaging Het
Atp2c2 A G 8: 119,726,354 E159G probably benign Het
Atrn A G 2: 130,979,969 I861V probably damaging Het
AW822073 T C 10: 58,223,672 probably benign Het
Clip1 A G 5: 123,603,654 V1053A possibly damaging Het
Cngb1 C A 8: 95,248,980 G629C probably damaging Het
Cntn5 A T 9: 9,743,652 F540Y probably damaging Het
Cpb1 A C 3: 20,275,584 probably null Het
Cyp4a14 A G 4: 115,496,083 Y11H probably benign Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dcstamp A T 15: 39,754,921 Y242F probably benign Het
Drd3 G T 16: 43,821,307 G329* probably null Het
Dysf T A 6: 84,008,963 S17T probably benign Het
Eno1 A T 4: 150,248,552 K366N possibly damaging Het
Ffar2 C T 7: 30,819,546 V190I probably benign Het
Fkbp15 T C 4: 62,324,192 T508A probably damaging Het
Fndc1 A G 17: 7,769,735 V1165A unknown Het
Foxj3 A T 4: 119,573,748 probably null Het
Gabarap T C 11: 69,991,804 probably null Het
Gm14025 T A 2: 129,036,811 D1065V unknown Het
Gm19410 T A 8: 35,803,582 L1221* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Igf1r A T 7: 68,201,250 Y931F probably benign Het
Il23r A T 6: 67,423,652 S565T probably damaging Het
Ipo8 A T 6: 148,816,497 Y209* probably null Het
Jph2 C T 2: 163,339,712 G511R probably benign Het
Khdrbs1 C A 4: 129,742,097 D22Y probably damaging Het
Ksr1 C T 11: 79,036,494 probably null Het
L3mbtl4 G T 17: 68,777,923 V610F probably benign Het
Lars2 A G 9: 123,454,760 T698A probably benign Het
Lonp1 A G 17: 56,621,961 V267A possibly damaging Het
Loxhd1 T A 18: 77,380,432 D925E probably damaging Het
Lsg1 A G 16: 30,574,568 L187P possibly damaging Het
Mki67 A T 7: 135,696,321 V2328E possibly damaging Het
Mlh3 A G 12: 85,268,497 I305T probably damaging Het
Mtbp A G 15: 55,557,620 M1V probably null Het
Myadml2 C A 11: 120,647,712 C99F probably benign Het
Ncbp1 A G 4: 46,150,703 Y185C probably damaging Het
Ndufaf7 A T 17: 78,943,310 Q222L probably null Het
Nlrp4b A T 7: 10,715,412 Y147F probably benign Het
Olfr1205 C T 2: 88,831,269 R51* probably null Het
Pet100 T C 8: 3,622,370 V15A probably benign Het
Pot1a A G 6: 25,778,870 V75A probably benign Het
Ptprs A T 17: 56,418,935 M1043K probably damaging Het
Rnf31 A G 14: 55,595,527 T413A probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Homo
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Rubcnl A T 14: 75,050,195 probably null Het
Ryr3 A T 2: 112,632,185 C4839S probably damaging Het
Scai A C 2: 39,102,328 D379E probably benign Het
Scd2 G T 19: 44,299,759 G197* probably null Het
Sdr39u1 A C 14: 55,897,709 I259S probably benign Het
Slco1a5 A T 6: 142,242,180 probably null Het
Sp1 A T 15: 102,430,883 T733S probably benign Het
Tecta A G 9: 42,343,755 S1711P probably damaging Het
Tedc1 G T 12: 113,161,355 W240L probably damaging Het
Trim50 A G 5: 135,353,600 K102R probably benign Het
Tusc5 T C 11: 76,680,529 S124P probably damaging Het
Utrn A G 10: 12,744,083 Y278H probably damaging Het
Vmn2r109 A C 17: 20,564,534 probably null Het
Zbed5 T C 5: 129,903,369 S720P possibly damaging Het
Zc3h3 A G 15: 75,839,455 S386P probably damaging Het
Zscan4-ps1 C T 7: 11,068,491 probably null Het
Other mutations in Kif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Kif5b APN 18 6226973 splice site probably benign
IGL01697:Kif5b APN 18 6226871 missense possibly damaging 0.68
IGL01759:Kif5b APN 18 6225647 missense probably damaging 0.99
IGL01759:Kif5b APN 18 6211019 unclassified probably benign
IGL02027:Kif5b APN 18 6209089 missense possibly damaging 0.81
IGL02553:Kif5b APN 18 6220914 missense probably benign 0.00
IGL03327:Kif5b APN 18 6222767 missense probably damaging 0.96
IGL03346:Kif5b APN 18 6222767 missense probably damaging 0.96
e-enhancer UTSW 18 6213272 missense probably benign 0.00
R0440:Kif5b UTSW 18 6226980 splice site probably benign
R0743:Kif5b UTSW 18 6209192 missense probably damaging 1.00
R1241:Kif5b UTSW 18 6214044 missense probably benign 0.07
R1386:Kif5b UTSW 18 6226383 missense probably damaging 0.99
R1720:Kif5b UTSW 18 6213427 missense probably benign
R1964:Kif5b UTSW 18 6209059 missense possibly damaging 0.85
R2061:Kif5b UTSW 18 6226377 splice site probably null
R2091:Kif5b UTSW 18 6213248 nonsense probably null
R4510:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4511:Kif5b UTSW 18 6214011 missense probably benign 0.01
R4515:Kif5b UTSW 18 6208257 missense probably benign
R4517:Kif5b UTSW 18 6213272 missense probably benign 0.00
R4690:Kif5b UTSW 18 6216759 missense probably benign
R4838:Kif5b UTSW 18 6216869 missense probably damaging 1.00
R4865:Kif5b UTSW 18 6222912 intron probably benign
R4906:Kif5b UTSW 18 6220930 missense probably benign 0.00
R5260:Kif5b UTSW 18 6211058 missense probably damaging 1.00
R5290:Kif5b UTSW 18 6234882 missense probably damaging 1.00
R5517:Kif5b UTSW 18 6220954 missense probably benign 0.00
R5588:Kif5b UTSW 18 6225787 missense probably benign 0.03
R5621:Kif5b UTSW 18 6226883 missense probably benign 0.41
R6269:Kif5b UTSW 18 6223558 missense possibly damaging 0.88
R6955:Kif5b UTSW 18 6211070 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGCGGTCTTAGAAACAGGACTAC -3'
(R):5'- TGGAATTCTAGGCTGAGGCAG -3'

Sequencing Primer
(F):5'- AGGACTACAGTCTTGCTTTCAC -3'
(R):5'- AGAGGTCAGGTTCCTAGTCAG -3'
Posted On2018-05-04