Incidental Mutation 'R6378:Ndufaf1'
ID515100
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119655726 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 302 (I302V)
Ref Sequence ENSEMBL: ENSMUSP00000106426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000028771] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably damaging
Transcript: ENSMUST00000028768
AA Change: I304V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: I304V

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110801
AA Change: I302V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: I302V

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110802
AA Change: I302V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: I302V

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154127
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Ctcf T A 8: 105,663,791 V10E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Frrs1 A G 3: 116,900,990 T487A possibly damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Ik T A 18: 36,757,288 I539N probably damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc25a47 G A 12: 108,856,143 R286H probably damaging Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
Trim43b T A 9: 89,085,399 I395L probably benign Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5460:Ndufaf1 UTSW 2 119660477 missense probably benign 0.02
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5777:Ndufaf1 UTSW 2 119660482 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R7202:Ndufaf1 UTSW 2 119658426 missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCAGAAGAACTTCCACTGAG -3'
(R):5'- GCAAACGAAAAGTGTACCATGC -3'

Sequencing Primer
(F):5'- AGAGGCCATGCTGTACTTAC -3'
(R):5'- AGTGTACCATGCTGAGGGC -3'
Posted On2018-05-04