Incidental Mutation 'R6378:Frrs1'
ID515107
Institutional Source Beutler Lab
Gene Symbol Frrs1
Ensembl Gene ENSMUSG00000033386
Gene Nameferric-chelate reductase 1
SynonymsSdfr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116859464-116908177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116900990 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 487 (T487A)
Ref Sequence ENSEMBL: ENSMUSP00000143255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040260] [ENSMUST00000195905] [ENSMUST00000199030]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040260
AA Change: T487A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039487
Gene: ENSMUSG00000033386
AA Change: T487A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 32 155 1.1e-34 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195905
AA Change: T487A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143255
Gene: ENSMUSG00000033386
AA Change: T487A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Reeler 31 156 4.6e-40 PFAM
low complexity region 171 184 N/A INTRINSIC
DoH 242 331 7.72e-9 SMART
B561 372 501 1.87e-42 SMART
transmembrane domain 514 536 N/A INTRINSIC
transmembrane domain 570 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197323
Predicted Effect probably benign
Transcript: ENSMUST00000199030
SMART Domains Protein: ENSMUSP00000142793
Gene: ENSMUSG00000033386

DomainStartEndE-ValueType
B561 1 99 1.5e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199584
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the cytochrome b561 (CYB561; MIM 600019) family, including FRRS1, reduce ferric to ferrous iron before its transport from the endosome to the cytoplasm (Vargas et al., 2003 [PubMed 14499595]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Ctcf T A 8: 105,663,791 V10E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Ik T A 18: 36,757,288 I539N probably damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Ndufaf1 T C 2: 119,655,726 I302V probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc25a47 G A 12: 108,856,143 R286H probably damaging Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
Trim43b T A 9: 89,085,399 I395L probably benign Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Frrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Frrs1 APN 3 116902400 missense probably damaging 1.00
IGL00792:Frrs1 APN 3 116885295 splice site probably null
IGL01395:Frrs1 APN 3 116901005 missense probably benign 0.02
IGL01504:Frrs1 APN 3 116900658 missense probably damaging 1.00
IGL01548:Frrs1 APN 3 116885185 missense probably damaging 1.00
IGL01924:Frrs1 APN 3 116885239 missense probably damaging 1.00
IGL03037:Frrs1 APN 3 116902467 unclassified probably benign
IGL03104:Frrs1 APN 3 116881782 missense probably benign 0.00
IGL03143:Frrs1 APN 3 116899187 missense probably damaging 0.99
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0023:Frrs1 UTSW 3 116896788 missense probably damaging 1.00
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0051:Frrs1 UTSW 3 116885297 splice site probably benign
R0107:Frrs1 UTSW 3 116896716 missense probably damaging 0.97
R0138:Frrs1 UTSW 3 116881807 missense possibly damaging 0.65
R0532:Frrs1 UTSW 3 116883164 missense probably benign
R0646:Frrs1 UTSW 3 116902421 missense possibly damaging 0.50
R1534:Frrs1 UTSW 3 116878408 missense probably benign 0.14
R1596:Frrs1 UTSW 3 116883199 intron probably benign
R1880:Frrs1 UTSW 3 116896795 critical splice donor site probably null
R2193:Frrs1 UTSW 3 116878345 missense probably damaging 1.00
R2851:Frrs1 UTSW 3 116885129 missense probably benign 0.00
R3177:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3277:Frrs1 UTSW 3 116899224 missense probably damaging 1.00
R3772:Frrs1 UTSW 3 116878387 missense possibly damaging 0.71
R4457:Frrs1 UTSW 3 116896728 missense probably benign 0.10
R4887:Frrs1 UTSW 3 116902416 makesense probably null
R4957:Frrs1 UTSW 3 116885248 missense probably benign 0.00
R5015:Frrs1 UTSW 3 116878439 missense probably damaging 1.00
R5080:Frrs1 UTSW 3 116902936 missense probably benign 0.02
R5256:Frrs1 UTSW 3 116903100 missense possibly damaging 0.88
R5280:Frrs1 UTSW 3 116880896 missense probably benign 0.00
R5597:Frrs1 UTSW 3 116878238 start gained probably benign
R5887:Frrs1 UTSW 3 116896750 missense probably benign 0.32
R6210:Frrs1 UTSW 3 116878431 missense probably benign 0.19
R6268:Frrs1 UTSW 3 116903099 missense probably damaging 0.98
X0063:Frrs1 UTSW 3 116902422 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGGCACTGCTTCTTTTGGC -3'
(R):5'- GCGTTTGGTCCTTATCAGAACC -3'

Sequencing Primer
(F):5'- GCAACGTAGAGATACTTGGCATCTTG -3'
(R):5'- ACTTGCCGTGTAAACAGC -3'
Posted On2018-05-04