Incidental Mutation 'R6378:Ctcf'
ID515127
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene NameCCCTC-binding factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location105636568-105682922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105663791 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 10 (V10E)
Ref Sequence ENSEMBL: ENSMUSP00000005841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005841
AA Change: V10E

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698
AA Change: V10E

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Frrs1 A G 3: 116,900,990 T487A possibly damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Ik T A 18: 36,757,288 I539N probably damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Ndufaf1 T C 2: 119,655,726 I302V probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc25a47 G A 12: 108,856,143 R286H probably damaging Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
Trim43b T A 9: 89,085,399 I395L probably benign Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 105677336 missense unknown
IGL01068:Ctcf APN 8 105681485 unclassified probably benign
IGL01936:Ctcf APN 8 105670232 missense probably benign 0.21
IGL02010:Ctcf APN 8 105664965 missense probably damaging 1.00
IGL02545:Ctcf APN 8 105664381 missense probably benign 0.39
IGL02617:Ctcf APN 8 105677210 splice site probably benign
R0255:Ctcf UTSW 8 105664039 missense possibly damaging 0.76
R0348:Ctcf UTSW 8 105676157 nonsense probably null
R0497:Ctcf UTSW 8 105675040 splice site probably benign
R1238:Ctcf UTSW 8 105671277 splice site probably benign
R1903:Ctcf UTSW 8 105675988 splice site probably null
R2508:Ctcf UTSW 8 105671384 missense probably damaging 1.00
R4035:Ctcf UTSW 8 105664157 missense possibly damaging 0.52
R4448:Ctcf UTSW 8 105680293 intron probably benign
R5106:Ctcf UTSW 8 105681498 unclassified probably benign
R6370:Ctcf UTSW 8 105664220 missense probably benign 0.05
R6392:Ctcf UTSW 8 105664133 missense probably damaging 0.97
R6737:Ctcf UTSW 8 105664508 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCTAATTCATTCACTAAGGTGGG -3'
(R):5'- AGGGTAGGATCCAGCTGTTC -3'

Sequencing Primer
(F):5'- AGAAATCTGCCTGCCTGTG -3'
(R):5'- GTAGGATCCAGCTGTTCCATCATTAC -3'
Posted On2018-05-04