Incidental Mutation 'R6378:Trim43b'
ID515130
Institutional Source Beutler Lab
Gene Symbol Trim43b
Ensembl Gene ENSMUSG00000079162
Gene Nametripartite motif-containing 43B
SynonymsGm8269
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location89084624-89092835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89085399 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 395 (I395L)
Ref Sequence ENSEMBL: ENSMUSP00000126594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167113] [ENSMUST00000189557]
Predicted Effect probably benign
Transcript: ENSMUST00000167113
AA Change: I395L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126594
Gene: ENSMUSG00000079162
AA Change: I395L

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 4e-8 BLAST
PDB:2VOK|B 329 445 3e-15 PDB
Blast:SPRY 336 441 9e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189557
AA Change: I394L

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139457
Gene: ENSMUSG00000079162
AA Change: I394L

DomainStartEndE-ValueType
RING 16 56 4.7e-9 SMART
Blast:BBOX 88 129 4e-8 BLAST
SPRY 334 444 8.1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Ctcf T A 8: 105,663,791 V10E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Frrs1 A G 3: 116,900,990 T487A possibly damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Ik T A 18: 36,757,288 I539N probably damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Ndufaf1 T C 2: 119,655,726 I302V probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc25a47 G A 12: 108,856,143 R286H probably damaging Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Trim43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Trim43b APN 9 89091642 missense probably benign 0.04
IGL01953:Trim43b APN 9 89085443 missense possibly damaging 0.74
IGL02160:Trim43b APN 9 89091630 missense probably benign 0.35
IGL02626:Trim43b APN 9 89085488 missense possibly damaging 0.89
IGL03199:Trim43b APN 9 89089428 missense probably damaging 0.98
R0477:Trim43b UTSW 9 89090601 missense probably damaging 1.00
R1345:Trim43b UTSW 9 89085672 missense possibly damaging 0.77
R1491:Trim43b UTSW 9 89087612 missense possibly damaging 0.52
R1536:Trim43b UTSW 9 89085358 nonsense probably null
R1862:Trim43b UTSW 9 89085571 missense probably damaging 1.00
R2211:Trim43b UTSW 9 89085249 missense possibly damaging 0.91
R4039:Trim43b UTSW 9 89091347 missense probably damaging 1.00
R4222:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4223:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4224:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4726:Trim43b UTSW 9 89089485 missense possibly damaging 0.70
R4812:Trim43b UTSW 9 89091480 missense probably benign 0.05
R4887:Trim43b UTSW 9 89091312 missense probably damaging 0.99
R5865:Trim43b UTSW 9 89085606 missense probably benign 0.19
R5909:Trim43b UTSW 9 89085398 missense possibly damaging 0.94
R6226:Trim43b UTSW 9 89091275 missense possibly damaging 0.82
R6531:Trim43b UTSW 9 89085365 missense probably damaging 1.00
R7114:Trim43b UTSW 9 89085608 missense probably benign 0.04
V5622:Trim43b UTSW 9 89092545 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCACTAGCATACTGGATTCCTATG -3'
(R):5'- AACCCATCGTGTTTCCTGGG -3'

Sequencing Primer
(F):5'- CCTATGATTATGTGTAGACAGCAGAG -3'
(R):5'- CTTCTCCAGGGGAAAATACTACTGG -3'
Posted On2018-05-04