Incidental Mutation 'R6378:Ik'
ID515160
Institutional Source Beutler Lab
Gene Symbol Ik
Ensembl Gene ENSMUSG00000024474
Gene NameIK cytokine
SynonymsMuRED
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R6378 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36744656-36757639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36757288 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 539 (I539N)
Ref Sequence ENSEMBL: ENSMUSP00000007042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042] [ENSMUST00000049323]
Predicted Effect probably damaging
Transcript: ENSMUST00000007042
AA Change: I539N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474
AA Change: I539N

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049323
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 A T 15: 73,123,925 D408E probably benign Het
Agpat2 T C 2: 26,596,135 N178S probably benign Het
Arsi T C 18: 60,916,501 F152S probably damaging Het
Atp13a2 T A 4: 141,007,056 L1163Q probably benign Het
Bpifb2 T A 2: 153,891,152 L385Q possibly damaging Het
C330018D20Rik A G 18: 56,962,507 L2P probably damaging Het
Cby3 A G 11: 50,359,533 T189A probably damaging Het
Cdc42bpa A T 1: 180,093,996 D567V possibly damaging Het
Cdh5 T A 8: 104,126,536 probably null Het
Cela1 C T 15: 100,687,190 V20I probably benign Het
Cmpk2 G A 12: 26,469,416 G22E possibly damaging Het
Ctcf T A 8: 105,663,791 V10E possibly damaging Het
Dpp10 C A 1: 123,411,739 C353F probably damaging Het
Efcab3 A G 11: 105,108,794 S5546G possibly damaging Het
Elp3 G T 14: 65,592,971 Y10* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eml4 T A 17: 83,448,217 W336R probably damaging Het
Erich6 T C 3: 58,622,359 probably null Het
Eya1 T C 1: 14,302,803 N31D possibly damaging Het
Fam103a1 A G 7: 81,767,639 Y29C probably damaging Het
Fam81a T A 9: 70,110,346 N106Y probably damaging Het
Frrs1 A G 3: 116,900,990 T487A possibly damaging Het
Ganc T C 2: 120,433,826 M420T probably damaging Het
Gimap7 A T 6: 48,724,182 E234V probably damaging Het
Gpbp1 T C 13: 111,433,612 N400S probably damaging Het
Gucy2g T C 19: 55,240,945 S98G probably benign Het
Hoxd10 T C 2: 74,694,334 I330T possibly damaging Het
Il17rb G A 14: 30,000,363 T237I probably damaging Het
Ing2 T A 8: 47,669,258 Q85L probably benign Het
Lrp4 C A 2: 91,493,829 N1208K probably benign Het
Lvrn T A 18: 46,894,957 S888R probably benign Het
Map2 T C 1: 66,415,329 V1126A probably damaging Het
Mapkapk5 A G 5: 121,539,170 probably null Het
Mis18bp1 T C 12: 65,149,247 D581G probably benign Het
Muc4 T C 16: 32,778,946 V3289A probably benign Het
Myom2 T A 8: 15,099,356 I609N probably benign Het
Nav1 A T 1: 135,454,695 M1343K probably damaging Het
Ndufaf1 T C 2: 119,655,726 I302V probably damaging Het
Neb T A 2: 52,293,721 K978N probably damaging Het
Nol8 A G 13: 49,667,355 E878G probably damaging Het
Nrde2 A T 12: 100,130,757 I928N probably damaging Het
Nxf1 T A 19: 8,764,546 D145E probably benign Het
Obox3 T A 7: 15,626,102 H214L probably benign Het
Obscn T C 11: 59,073,746 E3199G probably damaging Het
Ogfod3 T C 11: 121,202,935 E83G probably benign Het
Olfr1416 A G 1: 92,480,456 L55P probably damaging Het
Olfr281 T C 15: 98,456,544 V78A probably benign Het
Olfr457 T G 6: 42,471,753 M142L probably benign Het
Olfr96 T A 17: 37,225,797 V224E probably benign Het
Pcsk4 G T 10: 80,328,975 H69N probably benign Het
Plcl2 C T 17: 50,668,160 probably null Het
Pmfbp1 T C 8: 109,530,266 I534T probably damaging Het
Pqlc3 T C 12: 16,997,643 Y96C probably damaging Het
Prss23 A T 7: 89,510,033 I276N probably damaging Het
Rhd T A 4: 134,894,385 F403Y possibly damaging Het
Rsf1 CG CGACGGCGGAG 7: 97,579,908 probably benign Homo
Scg5 A G 2: 113,827,392 V58A possibly damaging Het
Scn5a C T 9: 119,486,036 G1868R probably damaging Het
Secisbp2l A G 2: 125,768,325 S225P possibly damaging Het
Sema4f A T 6: 82,917,632 L486* probably null Het
Slc25a47 G A 12: 108,856,143 R286H probably damaging Het
Slc5a8 A C 10: 88,905,054 K277T probably damaging Het
Sorcs1 T A 19: 50,225,177 E704V possibly damaging Het
Sptan1 T C 2: 30,018,515 S1768P probably damaging Het
Srd5a2 C T 17: 74,021,383 probably null Het
Sytl2 A T 7: 90,358,224 K65* probably null Het
Tas2r109 T G 6: 132,980,881 I29L probably benign Het
Tfap2a A T 13: 40,723,241 V234E possibly damaging Het
Tgfbr3 G A 5: 107,177,813 L128F probably benign Het
Trappc12 A T 12: 28,747,083 L150Q probably damaging Het
Trim43b T A 9: 89,085,399 I395L probably benign Het
U2surp C T 9: 95,491,421 E232K probably benign Het
Vax1 T C 19: 59,166,224 N327S probably benign Het
Vmn1r14 T C 6: 57,233,602 V11A probably benign Het
Vmn1r60 A G 7: 5,544,783 V106A probably damaging Het
Vmn2r106 T C 17: 20,278,405 S415G probably benign Het
Vmn2r3 C T 3: 64,275,096 G394D probably damaging Het
Ybx2 A G 11: 69,940,353 E63G possibly damaging Het
Zfhx4 T A 3: 5,243,350 N545K probably benign Het
Zp1 T C 19: 10,914,853 T56A probably benign Het
Other mutations in Ik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Ik APN 18 36756868 nonsense probably null
IGL01409:Ik APN 18 36756921 missense probably damaging 1.00
IGL01636:Ik APN 18 36751201 missense possibly damaging 0.63
IGL02282:Ik APN 18 36745644 missense probably damaging 0.99
IGL02422:Ik APN 18 36753260 critical splice acceptor site probably null
IGL03263:Ik APN 18 36748646 missense probably damaging 0.98
IGL03356:Ik APN 18 36756604 missense probably damaging 1.00
R0675:Ik UTSW 18 36747333 unclassified probably benign
R1778:Ik UTSW 18 36756818 unclassified probably benign
R4060:Ik UTSW 18 36748890 missense probably damaging 0.96
R4606:Ik UTSW 18 36753555 missense possibly damaging 0.68
R4684:Ik UTSW 18 36752414 missense probably damaging 1.00
R4819:Ik UTSW 18 36753257 splice site probably null
R4978:Ik UTSW 18 36747415 missense possibly damaging 0.54
R5256:Ik UTSW 18 36748873 missense probably benign 0.00
R5751:Ik UTSW 18 36753513 missense probably benign 0.07
R5966:Ik UTSW 18 36755478 missense possibly damaging 0.50
R6952:Ik UTSW 18 36753560 missense probably damaging 1.00
R7068:Ik UTSW 18 36755465 missense possibly damaging 0.57
R7143:Ik UTSW 18 36751177 missense probably damaging 1.00
R7242:Ik UTSW 18 36748222 missense probably null 1.00
Z1088:Ik UTSW 18 36744782 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGATCGACAGTGGAAG -3'
(R):5'- GTGGTGACAGCTGGAACTAG -3'

Sequencing Primer
(F):5'- AAGCTGTCCTTGAACTCAGG -3'
(R):5'- GCTGGAACTAGAGATTAGTACTTTG -3'
Posted On2018-05-04