Incidental Mutation 'R6380:Jph1'
ID515243
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Namejunctophilin 1
SynonymsENSMUSG00000054314, mitsugumin72, JP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location16964560-17097889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17091847 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 197 (N197S)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
Predicted Effect probably damaging
Transcript: ENSMUST00000038382
AA Change: N197S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: N197S

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17091740 missense probably damaging 1.00
IGL01382:Jph1 APN 1 17016156 missense probably damaging 1.00
IGL01936:Jph1 APN 1 17097384 missense probably damaging 0.98
IGL02012:Jph1 APN 1 17097414 missense probably benign 0.00
IGL02142:Jph1 APN 1 17091660 missense probably damaging 0.99
IGL02212:Jph1 APN 1 17091757 missense probably damaging 1.00
IGL02317:Jph1 APN 1 17003923 missense probably benign
IGL02450:Jph1 APN 1 17003977 missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17004451 missense probably benign
R0668:Jph1 UTSW 1 17091671 missense probably damaging 1.00
R0893:Jph1 UTSW 1 17004283 nonsense probably null
R1308:Jph1 UTSW 1 17091694 missense probably damaging 1.00
R1318:Jph1 UTSW 1 16997490 missense probably damaging 1.00
R1495:Jph1 UTSW 1 17091652 missense probably benign
R1712:Jph1 UTSW 1 17097232 missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17092055 missense probably damaging 1.00
R4492:Jph1 UTSW 1 16997546 missense probably damaging 1.00
R4559:Jph1 UTSW 1 17004511 missense probably benign
R4565:Jph1 UTSW 1 17004202 missense possibly damaging 0.91
R4694:Jph1 UTSW 1 16997505 missense probably damaging 0.98
R4700:Jph1 UTSW 1 17091704 missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17091611 missense probably damaging 1.00
R5029:Jph1 UTSW 1 17091391 missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17091398 missense probably benign 0.38
R5316:Jph1 UTSW 1 17091526 missense probably damaging 1.00
R5691:Jph1 UTSW 1 17004363 missense probably benign 0.21
R6209:Jph1 UTSW 1 17097586 missense probably damaging 0.98
R6645:Jph1 UTSW 1 17091761 missense probably damaging 1.00
R6829:Jph1 UTSW 1 17004423 missense probably damaging 1.00
R7007:Jph1 UTSW 1 17004186 missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17092042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCGCTAGAACTGATTCTGC -3'
(R):5'- TGGTCCCTGAAGACTCACAC -3'

Sequencing Primer
(F):5'- AGAACTGATTCTGCTCATGGC -3'
(R):5'- GGTCCCTGAAGACTCACACTATGTTG -3'
Posted On2018-05-04