Incidental Mutation 'R6380:Trpm1'
ID515265
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64268297 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 462 (T462S)
Ref Sequence ENSEMBL: ENSMUSP00000145593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect probably benign
Transcript: ENSMUST00000085222
AA Change: T1346S

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: T1346S

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205466
Predicted Effect probably benign
Transcript: ENSMUST00000206263
AA Change: T1230S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000206277
AA Change: T1352S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
AA Change: T462S

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.002 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAGGTCTGATCTGATCCAGG -3'
(R):5'- TCCGTGCTCTTGAAATCCG -3'

Sequencing Primer
(F):5'- GATCTGATCCAGGCTCGATC -3'
(R):5'- AACTCGCCTGCGGAGATG -3'
Posted On2018-05-04