Incidental Mutation 'R6380:Olfr586'
ID515268
Institutional Source Beutler Lab
Gene Symbol Olfr586
Ensembl Gene ENSMUSG00000066268
Gene Nameolfactory receptor 586
SynonymsMOR8-7, GA_x6K02T2PBJ9-5836380-5835439, MOR8-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103118403-103125638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103121929 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 281 (F281Y)
Ref Sequence ENSEMBL: ENSMUSP00000149226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084811] [ENSMUST00000211075] [ENSMUST00000213281] [ENSMUST00000215304]
Predicted Effect probably benign
Transcript: ENSMUST00000084811
AA Change: F285Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081872
Gene: ENSMUSG00000066268
AA Change: F285Y

DomainStartEndE-ValueType
Pfam:7tm_4 37 315 6.1e-111 PFAM
Pfam:7TM_GPCR_Srsx 41 312 1.6e-11 PFAM
Pfam:7tm_1 47 297 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211075
AA Change: F281Y

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000213281
AA Change: F281Y

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215304
AA Change: F281Y

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Olfr586
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Olfr586 APN 7 103121820 utr 3 prime probably benign
R0502:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0503:Olfr586 UTSW 7 103122436 missense possibly damaging 0.94
R0508:Olfr586 UTSW 7 103121986 missense possibly damaging 0.93
R0882:Olfr586 UTSW 7 103122575 missense probably benign 0.09
R0962:Olfr586 UTSW 7 103122010 missense possibly damaging 0.50
R1112:Olfr586 UTSW 7 103122404 missense probably damaging 1.00
R2226:Olfr586 UTSW 7 103121908 missense probably benign 0.06
R4285:Olfr586 UTSW 7 103122660 nonsense probably null
R5817:Olfr586 UTSW 7 103121908 missense possibly damaging 0.94
R6342:Olfr586 UTSW 7 103122356 missense probably damaging 0.99
R6565:Olfr586 UTSW 7 103122238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCTTAACTGATTCATTCTGTGC -3'
(R):5'- CTCTCACAGGCATCCTTGAC -3'

Sequencing Primer
(F):5'- GTGCGATTTTCTGACATCACAG -3'
(R):5'- AGGCATCCTTGACATAACCTTC -3'
Posted On2018-05-04