Incidental Mutation 'R6380:Ccnd1'
ID515271
Institutional Source Beutler Lab
Gene Symbol Ccnd1
Ensembl Gene ENSMUSG00000070348
Gene Namecyclin D1
SynonymsCycD1, Cyl-1, cD1, PRAD1, bcl-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144929931-144939925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144939569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 42 (V42A)
Ref Sequence ENSEMBL: ENSMUSP00000091495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093962]
Predicted Effect probably benign
Transcript: ENSMUST00000093962
AA Change: V42A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091495
Gene: ENSMUSG00000070348
AA Change: V42A

DomainStartEndE-ValueType
CYCLIN 62 146 1.2e-22 SMART
Cyclin_C 155 283 1.36e-18 SMART
CYCLIN 163 253 4.41e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208193
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations may exhibit reduced body size and viability, impaired retinal development, pregnancy-insensitive mammary glands, and modified development of mammary cancer induced by neu and ras oncogenes, depending on the specific allele or genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Stard6 G A 18: 70,476,388 V33I probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Ccnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0076:Ccnd1 UTSW 7 144939665 missense probably benign 0.00
R0544:Ccnd1 UTSW 7 144937286 splice site probably benign
R1549:Ccnd1 UTSW 7 144937336 missense probably benign
R2054:Ccnd1 UTSW 7 144937391 missense possibly damaging 0.95
R3895:Ccnd1 UTSW 7 144937894 missense probably damaging 0.98
R3962:Ccnd1 UTSW 7 144934050 missense probably damaging 1.00
R5624:Ccnd1 UTSW 7 144938012 missense probably benign 0.00
R5710:Ccnd1 UTSW 7 144938044 missense possibly damaging 0.82
R7352:Ccnd1 UTSW 7 144937387 missense possibly damaging 0.86
X0026:Ccnd1 UTSW 7 144937952 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACCGAGTCCTAGCAACGC -3'
(R):5'- TGTTGAAGTTGCAAAGTCCTG -3'

Sequencing Primer
(F):5'- GTCCTAGCAACGCACCCG -3'
(R):5'- GCAGAGAGCTACAGACTCCG -3'
Posted On2018-05-04