Incidental Mutation 'R6380:Stard6'
ID515291
Institutional Source Beutler Lab
Gene Symbol Stard6
Ensembl Gene ENSMUSG00000079608
Gene NameStAR-related lipid transfer (START) domain containing 6
Synonyms1700011K09Rik, 4833424I06Rik, 4933429L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6380 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location70472454-70501066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70476388 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 33 (V33I)
Ref Sequence ENSEMBL: ENSMUSP00000134511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067556] [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667] [ENSMUST00000212539] [ENSMUST00000212683]
Predicted Effect probably benign
Transcript: ENSMUST00000067556
SMART Domains Protein: ENSMUSP00000065118
Gene: ENSMUSG00000044906

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:LAS2 161 235 2.8e-26 PFAM
Pfam:LAS2 325 387 9.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114959
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164223
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168249
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
AA Change: V33I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174118
AA Change: V33I

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608
AA Change: V33I

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212539
Predicted Effect probably benign
Transcript: ENSMUST00000212683
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.5%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,160,891 probably null Het
4930590J08Rik G A 6: 91,923,137 G424D probably damaging Het
4932438A13Rik A G 3: 37,033,307 D4019G probably benign Het
Aco1 T C 4: 40,185,028 V566A probably benign Het
Adat1 G T 8: 111,978,072 T414K probably benign Het
Alox12e A G 11: 70,321,101 V194A probably benign Het
Anpep A G 7: 79,841,896 V119A probably benign Het
Atat1 C A 17: 35,908,957 probably null Het
Atp10a G A 7: 58,819,684 W1094* probably null Het
Bcl11b T C 12: 108,003,101 R15G probably benign Het
Btnl1 A G 17: 34,379,494 E28G probably benign Het
Ccnd1 A G 7: 144,939,569 V42A probably benign Het
Cdyl2 T A 8: 116,583,184 K344N probably damaging Het
Cep68 A G 11: 20,230,498 M711T probably benign Het
Cyp2j7 A G 4: 96,229,974 probably null Het
Cyp3a25 A T 5: 145,998,547 D86E probably damaging Het
Dclk1 G T 3: 55,247,194 R15L probably damaging Het
Dpy19l1 T A 9: 24,482,045 K143* probably null Het
Duox2 A G 2: 122,281,002 V1405A probably benign Het
Filip1 T C 9: 79,819,624 E571G probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Jph1 T C 1: 17,091,847 N197S probably damaging Het
Kcnt2 T C 1: 140,509,584 L535S probably damaging Het
Lepr C A 4: 101,764,954 S361* probably null Het
Lfng T A 5: 140,614,396 probably null Het
Lpcat2 G A 8: 92,886,581 A250T probably benign Het
Map3k4 A T 17: 12,272,067 M159K possibly damaging Het
Notch3 A T 17: 32,144,559 C1177S probably damaging Het
Olfml2b C T 1: 170,669,231 P477L probably benign Het
Olfr180 T A 16: 58,916,264 I126L probably damaging Het
Olfr586 A T 7: 103,121,929 F281Y probably benign Het
Olfr820 A T 10: 130,017,913 H184L probably benign Het
Pald1 G T 10: 61,350,935 F146L possibly damaging Het
Pcdhga1 A G 18: 37,662,969 D342G probably damaging Het
Plcb2 T C 2: 118,715,468 S579G probably damaging Het
Prdm16 A T 4: 154,341,367 S654T probably benign Het
Rab3gap2 C A 1: 185,235,984 L178I probably damaging Het
Rbfox1 C T 16: 7,224,350 Q23* probably null Het
Slc14a2 T G 18: 78,146,975 T920P probably benign Het
Slc17a6 G A 7: 51,667,463 V411M probably benign Het
Syce1 A T 7: 140,779,065 H178Q probably damaging Het
Syne2 T A 12: 76,104,980 F1872I probably damaging Het
Tor1aip1 T C 1: 156,018,488 E274G possibly damaging Het
Trpm1 A T 7: 64,268,297 T462S probably benign Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn1r178 A G 7: 23,893,559 T11A possibly damaging Het
Vmn2r69 A T 7: 85,411,859 N172K probably benign Het
Whrn G T 4: 63,418,592 P136T possibly damaging Het
Zfhx4 A G 3: 5,413,110 N3570S probably damaging Het
Zfp689 A G 7: 127,444,796 S221P probably damaging Het
Other mutations in Stard6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Stard6 APN 18 70483488 missense probably benign 0.00
IGL02403:Stard6 APN 18 70496112 critical splice acceptor site probably null
IGL02934:Stard6 APN 18 70496104 splice site probably benign
IGL03144:Stard6 APN 18 70476111 missense possibly damaging 0.53
R0344:Stard6 UTSW 18 70496115 missense probably damaging 1.00
R2850:Stard6 UTSW 18 70483451 missense probably benign 0.20
R2896:Stard6 UTSW 18 70476388 missense probably benign 0.02
R3236:Stard6 UTSW 18 70500486 missense probably damaging 0.99
R4532:Stard6 UTSW 18 70483534 missense probably damaging 1.00
R4959:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R4973:Stard6 UTSW 18 70498560 missense possibly damaging 0.92
R5080:Stard6 UTSW 18 70496222 missense probably damaging 1.00
R7331:Stard6 UTSW 18 70483482 missense probably damaging 1.00
R7396:Stard6 UTSW 18 70500435 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGACCTATCTGGCTGGAAACTC -3'
(R):5'- AGCACGTGATCTCACACATC -3'

Sequencing Primer
(F):5'- GGCTGGAAACTCATTAAATCTTCAG -3'
(R):5'- AGCACGTGATCTCACACATCATTTC -3'
Posted On2018-05-04