Incidental Mutation 'R6382:Lrrc40'
ID515357
Institutional Source Beutler Lab
Gene Symbol Lrrc40
Ensembl Gene ENSMUSG00000063052
Gene Nameleucine rich repeat containing 40
Synonyms2610040E16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6382 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location158036662-158068487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158058696 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 416 (D416G)
Ref Sequence ENSEMBL: ENSMUSP00000071956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072080] [ENSMUST00000150525] [ENSMUST00000156597]
Predicted Effect probably damaging
Transcript: ENSMUST00000072080
AA Change: D416G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071956
Gene: ENSMUSG00000063052
AA Change: D416G

DomainStartEndE-ValueType
LRR 81 100 7.11e1 SMART
LRR 104 126 6.13e-1 SMART
LRR 127 149 1.51e0 SMART
LRR_TYP 150 172 8.47e-4 SMART
LRR 173 195 3.52e-1 SMART
LRR_TYP 196 219 2.91e-2 SMART
LRR 242 261 9.15e0 SMART
LRR 265 287 1.01e2 SMART
LRR 288 310 1.86e1 SMART
LRR 311 334 2.32e-1 SMART
LRR 335 356 2.21e2 SMART
LRR 471 493 1.86e0 SMART
LRR 494 517 8.97e0 SMART
LRR 541 564 1.53e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132530
Predicted Effect probably benign
Transcript: ENSMUST00000150525
SMART Domains Protein: ENSMUSP00000116475
Gene: ENSMUSG00000063052

DomainStartEndE-ValueType
SCOP:d1fqva2 81 111 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199290
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,600,986 M148K probably benign Het
Aldoc T C 11: 78,325,742 I242T probably benign Het
Camta2 T C 11: 70,672,041 T927A probably damaging Het
Ccdc105 G A 10: 78,752,841 T45I possibly damaging Het
Ccdc30 T C 4: 119,404,166 R25G possibly damaging Het
Cdh16 T A 8: 104,621,543 M181L possibly damaging Het
Clstn1 A T 4: 149,626,120 probably null Het
Cnot6l C A 5: 96,128,999 R110L probably damaging Het
Col7a1 G A 9: 108,975,393 S2264N unknown Het
Cspp1 A G 1: 10,083,475 probably null Het
Cul1 T A 6: 47,502,439 L213Q probably damaging Het
Cuta T C 17: 26,938,454 Q124R probably benign Het
Cyp1a1 T A 9: 57,700,690 N200K probably damaging Het
Dag1 C A 9: 108,208,137 A602S possibly damaging Het
Gm4707 G A 17: 71,459,243 probably benign Het
Gm813 T C 16: 58,613,910 E148G possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
H2-T23 T C 17: 36,031,832 Y138C probably damaging Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hpse2 A G 19: 43,388,202 L37P possibly damaging Het
Hsd17b6 A T 10: 127,991,327 I292N probably damaging Het
Hsp90aa1 A T 12: 110,695,517 probably null Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Igkv10-95 A G 6: 68,680,688 T43A probably benign Het
Igkv6-17 C T 6: 70,371,830 Q62* probably null Het
Jakmip2 A G 18: 43,571,179 S367P possibly damaging Het
Mdm2 A G 10: 117,692,721 V177A probably benign Het
Mpp1 TGAGACGAACTCTCCGAG TGAG X: 75,125,769 probably null Het
Myo1b C T 1: 51,774,307 probably null Het
Notch2 A G 3: 98,141,543 D1799G probably damaging Het
Obscn C T 11: 58,999,413 G7431D unknown Het
Obscn A T 11: 59,042,208 C4781S probably damaging Het
Olfr1351 C A 10: 79,017,517 S65Y probably damaging Het
Olfr237-ps1 T A 6: 43,153,965 I220N probably damaging Het
Pard3 T A 8: 127,376,783 V411D probably damaging Het
Pfkl T C 10: 77,999,837 R246G probably damaging Het
Pgs1 T C 11: 118,003,360 Y238H probably damaging Het
Pik3c2g A G 6: 139,719,998 E15G possibly damaging Het
Pja2 A G 17: 64,309,615 V95A probably benign Het
Ripor2 T C 13: 24,677,845 I207T possibly damaging Het
Rps15 A G 10: 80,293,986 Y115C probably damaging Het
Shkbp1 C A 7: 27,352,059 E192* probably null Het
Slc23a4 T A 6: 34,957,043 M42L probably benign Het
Snx25 T A 8: 46,055,991 S373C probably benign Het
Sppl2a A T 2: 126,917,029 probably null Het
Tpcn2 A G 7: 145,269,749 S256P possibly damaging Het
Txk C T 5: 72,736,480 probably benign Het
Ubr2 C G 17: 46,957,315 W991S possibly damaging Het
Ufc1 A G 1: 171,294,675 W28R probably damaging Het
Unc93b1 C A 19: 3,935,297 A35E probably benign Het
Ush2a A G 1: 188,814,302 N3425S probably benign Het
Vmn1r32 A G 6: 66,553,361 Y144H probably benign Het
Vmn1r76 A G 7: 11,930,499 F228L probably damaging Het
Zfc3h1 A G 10: 115,407,908 N715D probably benign Het
Zfp933 T C 4: 147,825,868 S424G probably benign Het
Other mutations in Lrrc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Lrrc40 APN 3 158048450 missense probably damaging 1.00
IGL00501:Lrrc40 APN 3 158061282 missense probably damaging 0.96
IGL00727:Lrrc40 APN 3 158063871 critical splice donor site probably null
IGL01349:Lrrc40 APN 3 158058665 splice site probably benign
IGL02377:Lrrc40 APN 3 158036728 start codon destroyed probably null 1.00
IGL02490:Lrrc40 APN 3 158062699 missense probably damaging 1.00
IGL02657:Lrrc40 APN 3 158036773 missense probably damaging 1.00
IGL02879:Lrrc40 APN 3 158041665 intron probably benign
IGL02944:Lrrc40 APN 3 158041665 intron probably benign
IGL02954:Lrrc40 APN 3 158041665 intron probably benign
IGL02966:Lrrc40 APN 3 158041665 intron probably benign
IGL03004:Lrrc40 APN 3 158041665 intron probably benign
IGL03032:Lrrc40 APN 3 158041665 intron probably benign
IGL03112:Lrrc40 APN 3 158041665 intron probably benign
IGL03163:Lrrc40 APN 3 158041587 missense possibly damaging 0.82
I2288:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
R0266:Lrrc40 UTSW 3 158041661 critical splice donor site probably null
R0355:Lrrc40 UTSW 3 158040471 missense probably damaging 0.99
R0457:Lrrc40 UTSW 3 158054564 intron probably null
R0968:Lrrc40 UTSW 3 158036789 missense probably damaging 1.00
R1799:Lrrc40 UTSW 3 158036804 missense probably benign 0.38
R1962:Lrrc40 UTSW 3 158040449 missense probably benign 0.01
R4614:Lrrc40 UTSW 3 158054634 missense probably damaging 1.00
R4825:Lrrc40 UTSW 3 158061330 nonsense probably null
R4857:Lrrc40 UTSW 3 158066229 utr 3 prime probably benign
R4947:Lrrc40 UTSW 3 158063835 missense probably benign 0.00
R5148:Lrrc40 UTSW 3 158054569 splice site probably null
R5673:Lrrc40 UTSW 3 158048398 splice site probably null
R6354:Lrrc40 UTSW 3 158061264 nonsense probably null
R6713:Lrrc40 UTSW 3 158063713 missense probably benign 0.00
R7081:Lrrc40 UTSW 3 158036805 missense probably damaging 0.98
R7098:Lrrc40 UTSW 3 158041639 missense probably benign 0.29
V1662:Lrrc40 UTSW 3 158052789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATTTCCCAAGTGCTTCTG -3'
(R):5'- CCACAGTGTGCAGCATTCTC -3'

Sequencing Primer
(F):5'- TCTGCTTCTGAGGATGAACAGAGC -3'
(R):5'- GTGCAGCATTCTCTCACATTAATAG -3'
Posted On2018-05-04