Incidental Mutation 'R6384:Cyp2c38'
ID515527
Institutional Source Beutler Lab
Gene Symbol Cyp2c38
Ensembl Gene ENSMUSG00000032808
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 38
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39389556-39463075 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 39392293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035488]
Predicted Effect probably null
Transcript: ENSMUST00000035488
SMART Domains Protein: ENSMUSP00000044722
Gene: ENSMUSG00000032808

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 1.5e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Cyp2c38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Cyp2c38 APN 19 39460725 nonsense probably null
IGL01109:Cyp2c38 APN 19 39462885 critical splice donor site probably null
IGL01521:Cyp2c38 APN 19 39460670 missense probably damaging 0.99
IGL02036:Cyp2c38 APN 19 39460316 missense probably null 0.97
IGL02187:Cyp2c38 APN 19 39436205 missense probably benign 0.14
IGL02954:Cyp2c38 APN 19 39391076 missense probably damaging 0.99
R0479:Cyp2c38 UTSW 19 39463005 missense probably damaging 0.99
R0684:Cyp2c38 UTSW 19 39391056 missense probably damaging 0.99
R0919:Cyp2c38 UTSW 19 39404669 missense probably benign 0.07
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1462:Cyp2c38 UTSW 19 39392188 missense probably damaging 0.96
R1642:Cyp2c38 UTSW 19 39401709 missense probably damaging 1.00
R1715:Cyp2c38 UTSW 19 39404795 missense probably benign 0.25
R1900:Cyp2c38 UTSW 19 39438312 missense probably benign 0.40
R1954:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R1955:Cyp2c38 UTSW 19 39404687 missense probably damaging 0.99
R2860:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2861:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R2862:Cyp2c38 UTSW 19 39460694 missense probably benign 0.01
R3084:Cyp2c38 UTSW 19 39401701 missense probably benign 0.00
R3727:Cyp2c38 UTSW 19 39392295 splice site probably benign
R4648:Cyp2c38 UTSW 19 39460688 missense probably benign 0.05
R5119:Cyp2c38 UTSW 19 39460621 missense probably damaging 1.00
R5636:Cyp2c38 UTSW 19 39438306 nonsense probably null
R5651:Cyp2c38 UTSW 19 39460712 missense probably damaging 0.99
R6263:Cyp2c38 UTSW 19 39392215 missense probably damaging 1.00
R6853:Cyp2c38 UTSW 19 39438304 missense probably benign 0.02
R6915:Cyp2c38 UTSW 19 39436068 missense probably damaging 0.99
R7201:Cyp2c38 UTSW 19 39401776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCCCTGGGAATGAGTTTC -3'
(R):5'- AACTTTATATGCCCCAGAACAGG -3'

Sequencing Primer
(F):5'- CCATTACCTGCTGAGAAAGTCATG -3'
(R):5'- GACTTTTGGTATAGCATTGGAAATG -3'
Posted On2018-05-04