Incidental Mutation 'R6385:Zc3h11a'
ID515531
Institutional Source Beutler Lab
Gene Symbol Zc3h11a
Ensembl Gene ENSMUSG00000116275
Gene Name
Synonyms1110003F06Rik, 5730454B08Rik, G630041M05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133619871-133661380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133637454 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 236 (S236T)
Ref Sequence ENSEMBL: ENSMUSP00000141255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195424]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027736
AA Change: S236T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275
AA Change: S236T

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179598
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186476
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191896
AA Change: S236T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976
AA Change: S236T

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000195669
AA Change: S112T
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Zc3h11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Zc3h11a APN 1 133625862 missense probably benign
IGL01961:Zc3h11a APN 1 133627067 missense probably benign 0.12
IGL02005:Zc3h11a APN 1 133622142 missense probably benign
IGL02365:Zc3h11a APN 1 133637413 missense probably benign 0.02
IGL02454:Zc3h11a APN 1 133624516 missense probably benign 0.09
PIT4449001:Zc3h11a UTSW 1 133624611 missense probably benign 0.22
R0180:Zc3h11a UTSW 1 133621611 missense probably benign 0.11
R0965:Zc3h11a UTSW 1 133645803 missense possibly damaging 0.80
R1389:Zc3h11a UTSW 1 133633803 missense probably damaging 0.99
R1607:Zc3h11a UTSW 1 133624687 missense probably benign
R1639:Zc3h11a UTSW 1 133624708 missense probably benign 0.03
R1720:Zc3h11a UTSW 1 133621701 missense probably damaging 0.97
R1728:Zc3h11a UTSW 1 133622154 missense probably benign
R1728:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1729:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133622154 missense probably benign
R1730:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1739:Zc3h11a UTSW 1 133622154 missense probably benign
R1739:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1762:Zc3h11a UTSW 1 133622154 missense probably benign
R1762:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1783:Zc3h11a UTSW 1 133622154 missense probably benign
R1783:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1784:Zc3h11a UTSW 1 133622154 missense probably benign
R1784:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R1785:Zc3h11a UTSW 1 133622154 missense probably benign
R1785:Zc3h11a UTSW 1 133624621 missense probably benign 0.20
R2508:Zc3h11a UTSW 1 133624783 missense probably benign 0.01
R4792:Zc3h11a UTSW 1 133640698 missense probably damaging 0.98
R4901:Zc3h11a UTSW 1 133624711 missense probably benign 0.00
R4932:Zc3h11a UTSW 1 133624612 missense probably benign 0.00
R5135:Zc3h11a UTSW 1 133633789 missense probably benign 0.00
R5186:Zc3h11a UTSW 1 133621674 missense probably damaging 0.99
R5357:Zc3h11a UTSW 1 133623042 missense probably damaging 1.00
R5438:Zc3h11a UTSW 1 133640647 missense probably damaging 1.00
R6149:Zc3h11a UTSW 1 133638875 nonsense probably null
R6268:Zc3h11a UTSW 1 133624557 missense probably benign 0.01
R6847:Zc3h11a UTSW 1 133638962 splice site probably null
R7107:Zc3h11a UTSW 1 133638917 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTTCAAGTCCTCCTAAAACTCCAAAG -3'
(R):5'- TATTCAAGTGGGAGCACAGG -3'

Sequencing Primer
(F):5'- GTCCTCCTAAAACTCCAAAGTAATC -3'
(R):5'- GCATTGCCAAGGCTGATG -3'
Posted On2018-05-04