Incidental Mutation 'R6385:Olfr231'
ID515533
Institutional Source Beutler Lab
Gene Symbol Olfr231
Ensembl Gene ENSMUSG00000046486
Gene Nameolfactory receptor 231
SynonymsOlfr244, GA_x6K02T2LER7-6-623, Olfr425, GA_x6K02T2P20D-21053942-21054499, GA_x6K02T02K39-452-3, MOR105-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174113211-174121162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174117296 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 240 (F240Y)
Ref Sequence ENSEMBL: ENSMUSP00000151011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063030] [ENSMUST00000214446]
Predicted Effect probably damaging
Transcript: ENSMUST00000063030
AA Change: F240Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059596
Gene: ENSMUSG00000046486
AA Change: F240Y

DomainStartEndE-ValueType
Pfam:7tm_4 24 300 2.6e-63 PFAM
Pfam:7tm_1 34 282 2.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214446
AA Change: F240Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Olfr231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Olfr231 APN 1 174117533 missense probably damaging 1.00
IGL03126:Olfr231 APN 1 174117710 missense probably benign 0.07
R0200:Olfr231 UTSW 1 174117512 missense probably benign 0.00
R1292:Olfr231 UTSW 1 174117854 missense probably benign 0.16
R1966:Olfr231 UTSW 1 174117251 nonsense probably null
R2860:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2861:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R2862:Olfr231 UTSW 1 174117732 missense probably damaging 1.00
R4492:Olfr231 UTSW 1 174117204 missense probably benign 0.01
R4594:Olfr231 UTSW 1 174117320 missense probably damaging 0.96
R4670:Olfr231 UTSW 1 174117861 missense probably benign 0.04
R4703:Olfr231 UTSW 1 174117398 missense possibly damaging 0.52
Z1088:Olfr231 UTSW 1 174117315 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GAGCCCGAACATCTCTCTTC -3'
(R):5'- GTGATTTCACCCCTGTGCTCAG -3'

Sequencing Primer
(F):5'- CATCTCTCTTCTGATGAAAAAGCC -3'
(R):5'- CAGTTTGGCCTGTACGGATACATC -3'
Posted On2018-05-04